We present an effective and reproducible method to isolate and culture neural progenitor cells from embryonic and postnatal brain tissue for chromatin immunoprecipitation (ChIP) of histone 3 lysine 79 dimethylation (H3K79me2) – a histone mark located within the globular domain of histone 3.
Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. Additionally, epigenetic chromatin modifications, like histone methylation, have an important role for establishing and maintaining specific cell fates within this process. The vast majority of histone methylation occurs on the flexible histone tail, which is accessible to histone modifiers, erasers, and histone reader proteins. In contrast, H3K79 methylation is located in the globular domain of histone 3 and is implicated in different developmental functions. H3K79 methylation is evolutionarily conserved and can be found in a wide range of species from Homo sapiens to Saccharomyces cerevisiae. The modification occurs in different cell populations within organisms, including neural progenitors. The location of H3K79 methylation in the globular domain of histone 3 makes it difficult to assess. Here, we present methods to isolate and culture cortical progenitor cells (CPCs) from embryonic cortical brain tissue (E11.5-E14.5) or cerebellar granular neuron progenitors (CGNPs) from postnatal tissue (P5-P7), and to efficiently immunoprecipitate H3K79me2 for quantitative PCR (qPCR) and genome-wide sequencing.
The sensory, motor, and cognitive functions of the brain are highly complex and susceptible to physical and environmental changes. The brain consists of three general parts the hind-, mid-, and forebrain, which are deeply connected. Within the forebrain, the telencephalon can be divided into a dorsal telencephalon (DT) and a ventral telencephalon (VT). The DT of mice consists of six cortical layers which are formed between E11.5 and E18.5 in an "inside-out" manner1. The VT includes the ganglionic eminences in development, which later form the basal ganglia2,3. Several cell types can be classified in the mammalian central nervous system such as neurons, astrocytes, or oligodendrocytes4, which develop in a temporo-spatial manner5. First, the neural progenitor cells (NPCs) give rise to different kinds of neurons, interneurons in the VT, and projection neurons in the DT, and later on to glial cells (e.g., astrocytes6). During cortical development, the most superficial layer (layer I), which contains Cajal-Retzius cells, is formed first. Then, between E12.5 and E14.5, NPCs generate deeper neuronal layers (VI, V) while between 14.5 and 16.5, progenitors give rise to upper layer (IV-II) neurons7,8. Neuronal identity is specified by different morphogen-induced temporo-spatial transcriptional programs and additionally by epigenetic programs2.
The cerebellum, which is implicated in motor coordination, is located in the hindbrain and develops between E10 and roughly P20 in mice9. It contains the cerebellar cortex and the cerebellar nuclei10. The adult cerebellar cortex consists of three layers, the outermost molecular layer, the Purkinje cell layer, and the innermost granular layer containing granular neurons10. The cerebellar granule cells are the smallest neurons and represent about 80% of all neurons in the vertebrate brain11. They develop from precursors located in the external germinal zone and migrate through the Purkinje cell layer to their destination12. Like in the telencephalon, the development of the cerebellum is regulated by several important morphogens, which have specific time- and space-dependent functions and initiate defined transcriptional programs10.
The development of cortical and cerebellar layers is controlled by transcriptional expression of specific morphogens and, thus, by the chromatin state of the DNA. In a simplified view, chromatin states can be divided into euchromatin as transcriptionally active and heterochromatin as transcriptionally silent regions. The nucleosome as the basic unit of chromatin contains two copies of each core histone H2A, H2B, H3, and H4, surrounded by 147 base pairs of DNA13. Histones are highly post-translationally modified by methylation, acetylation, phosphorylation, ubiquitination, sumoylation, ADP-ribosylation, deamination, and proline isomerization14,15. Histone lysine methylation is considered to be the most stable histone modification that controls transcription, replication, recombination16, DNA-damage response17, and genomic imprinting18. Lysines can be mono-, di-, or tri-methylated19 and appear not only on the accessible histone tails but also within the globular domain of histones20. Specific methylations at H3K4 and H3K36 are mainly associated with euchromatin, specific methylations at H3K9, H3K27, or H4K20 are mainly found in heterochromatic regions, although all residues are located within the histone tail14,19,21. H3K79 methylation is located within the histone globular domain and has been associated with transcriptional activity, but also with transcriptionally inert genomic regions22. The modification is evolutionarily conserved since it has been observed in yeast, calf thymus, chicken, and human23. H3K79 mono, di, and trimethylation (H3K79me1, me2, me3) are catalyzed by the histone methyltransferases DOT1L24,25 and the Nuclear SET Domain-Containing Protein 2 (Nsd2)26. DOT1L is implicated in proliferation, DNA repair, and cellular reprograming27. Loss of Dot1l in mice leads to a prenatal death around the developmental stage E10.528,29. During heart development and in myocardiocyte differentiation, DOT1L is essential for gene expression regulation30. In the central nervous system, DOT1L function might be implicated in neural tube development31, it is involved in suppressing Tbr1-expression during forebrain development32, and may function in the regulation of ER-stress response genes33. The context-dependent activating or repressing action of H3K79me, especially with in vivo situations like the development of the central nervous system, is to date only partially understood32. Since H3K79 methylation is located in the globular domain of histone 3, it is sterically less accessible in comparison to modifications on the flexible histone tails23. To understand the function of H3K79 methylation, reliable and reproducible analysis methods to determine its location and genomic environment are needed. In this methods paper, we present isolation methods of different neural progenitors (CPCs for the cortex and CGNPs for the cerebellum), effective DOT1L inhibitor treatment, and a ChIP method to analyze H3K79 methylation via qPCR or sequencing at different time points during cortical and cerebellar development. For an overview of the protocol and its possibilities, see Figure 1.
Animal welfare committees of the University of Freiburg and local authorities approved all animal experiments (G12/13, G16/11) mentioned in the following protocol.
1. Preparations
2. Neural Progenitor Isolation of Brain Tissue
3. Fixation of Cells and Shearing of Chromatin
NOTE: Perform steps 3.1 and 3.2 if cells are not cultured, if they are proceed to step 3.3.
4. Preparation of the Beads and Preclearing
5. Chromatin Immunoprecipitation
6. Purification of ChIP samples
7. Analysis of ChIP Samples via qPCR
8. Analysis of ChIP samples via Sequencing
General scheme of neural progenitor isolation, cultivation, H3K79me2 ChIP and ChIP analysis methods: Figure 1 shows a flowchart to perform H3K79me2 ChIP of cortical progenitor cells at different time points during embryonic brain development or of cerebellar granular neuron progenitors in postnatal stages. As a first step, the brain has to be isolated and the telencephalon (between E11.5 and E14.5) or the cerebellum (P5-P7) has to be retrieved. It is possible to analyze the different regions of the telencephalon by dividing it into the DT and VT. Afterwards the tissue will be homogenized and the neural progenitors segregated. Now, it is possible to culture the progenitor cells and treat them with DOT1L inhibitors. Another possibility is to fix the progenitors directly and subject them to the ChIP procedure. For ChIP, the chromatin will be sheared into fragments of 200-500 bp and incubated subsequently with magnetic-beads-coupled antibody against H3K79me2. After washing the beads and retrieving the DNA, the precipitated DNA can be analyzed by sequencing or by qPCR (Figure 1A). It is essential to have a good size distribution of the chromatin fragments after shearing, so it is advisable to check the fragment size with DNA gel electrophoresis or with other methods (examples in Figure 1B). When choosing genome-wide sequencing, ChIP-seq-reads for H3K79me2 occupancy will be provided as a fastq-file for further analysis (Figure 1C). The quality of the sequencing reads needs to be assessed by application of FastQC and, if necessary, the fastq-files can be trimmed using TrimGalore. Mapping to the Mus musculus genome mm9 or mm10 can be performed with Bowtie2 and controlled via PlotFingerprint. It is advisable to remove duplicates with MarkDuplicates and to normalize the reads by BamCoverage and to compare the ChIP to the input samples with BamCompare. The ChIP-seq reads can subsequently be visualized genome wide in heatmaps or gene-wise in Integrative Genomics Viewer (IGV) browser sessions.
CPC culture and DOT1L inhibition: CPCs were isolated and treated with 5 µM DOT1L inhibitor SGC0946 at day 0 and day 2. The solvent DMSO was used as a control. At day 3, CPCs were harvested, the proteins were isolated, quantified, and analyzed via immunoblot (Figure 2A). Figure 2A shows that H3K79me2 levels are effectively decreased after three days of CPC culturing and DOT1L inhibition ensuring an effective inhibitor treatment scheme. The protein amount of H3, GAPDH, or Tubulin-alpha serving as loading controls was thereby not impaired. Immunostaining of fixed CPCs with antibodies against active caspase 3 (CASP3+) for detecting apoptosis and HuC/D for visualizing neuronal cells indicated that treatment of CPCs with DOT1L inhibitor led to increased cell death after three days in culture, as shown in Figure 2B. Quantification of the cells which are CASP3+/DAPI+ or HuC/D+/DAPI+ within the CPC culture revealed a significant rise of CASP3+ cells revealing programmed cell death upon DOT1L inhibition. The number of HuC/D-positive neurons, however, remained unchanged (Figure 2C).
H3K79me2 ChIP-qPCR of Aft4, Ddit3, Scd1, Aft3, and Npm1 from CPCs treated with DOT1L inhibitor: To test if the SGC0946 inhibitor treatment of DOT1L was efficient and led to a reduction of H3K79me2 at specific genes, we performed a ChIP analysis followed by qPCR of CPC treated for 3 days. Rabbit IgG was used as a ChIP control. Since it is known that H3K79me2 is located at the endoplasmatic stress-responsive genes Aft4, Ddit3, Scd1, and Aft3 as well at the nuclear transport gene Npm133,38, we used qPCR primers covering the TSS, the TES, and genomic regions within the gene bodies to determine differences in H3K79me2 distribution after DOT1L inhibition (Figure 3A). Genes with high H3K79me2 levels in the first place such as Atf4, Ddit3, and Npm1 were most responsive to the inhibitor treatment so that three days of inhibition of DOT1L led to a significant decrease of H3K79me2. Genes with a lower H3K79me2 coverage, such as Atf3 and Scd1, showed no significant change in H3K79me2 levels.
Overview of H3K79me2 ChIP-seq analysis: Genome-wide analysis of the H3K79me2 levels in CPCs from E14.5, performed and analyzed according to the presented schemes and protocols (Figure 1), revealed a very high quality ChIP. Whereas the binned counts, sorted according to their frequency of the input reads in the Fingerprint blot (Figure 4A), were evenly distributed, the H3K79me2 counts showed enrichment at specific regions (bins ranked with 1), which displays successful accumulation of chromatin fragments modified at H3K79. A heatmap of H3K79me2 along genes between their TSS and their TES and +/-10Kb upstream or downstream shows (Figure 4B) that H3K79me2 peaks around the TSS and decreased towards the TES in general. There are genes, which are completely covered with H3K79me2, and genes, which have a peak only within the TSS region. Endoplasmatic-stress related genes such as Atf4, Ddit3, and the nucleophosmin Npm1 harbor, for instance, a high H3K79me2 level at the TSS, which is only slightly decreased along the whole gene body (Figure 4C). In contrast, Scd1 has a low H3K79me2 occupancy at the TSS and no H3K79me2 within the gene body. Atf3 as a last example has different sharp and low level H3K79me2 peaks along the gene body.
Figure 1: Scheme of H3K79me2 ChIP protocol from isolated CPCs or CGNPs and flowchart of sequencing analysis. (A) Overview of presented protocol. For CPC isolation, first E14.5 brains will be isolated and the cortices can be divided into DT and VT, if needed. For CGNPs, cerebelli have to be retrieved from P5-P7 mice. The tissue will be homogenized, the progenitors segregated, and then the cells can be cultured and treated with an appropriate inhibitor or directly used for ChIP. For ChIP, fixation of the chromatin is followed by shearing and immunoprecipitation with an anti-H3K79me2 antibody and rabbit IgG as control. After the DNA purification, ChIP samples can be analyzed via library preparation and sequencing or can be analyzed via qPCR. (B) Examples of appropriate and inappropriate quality chromatin. The DNA fragment distribution is shown in bp. (C) ChIP-seq results can be subjected to an analysis pipeline on the Freiburg/Galaxy server. After a quality control (FastQC), reads may be trimmed with TrimGalore and then mapped via Bowtie2 to the mouse genome (in the presented cases mm9). PlotFingerprint evaluates the quality of the ChIP. To define peaks for H3K79me2, MACSpeaks can be applied. For normalization BamCoverage and for comparison to the input BamCompare are usable. To visualize the results IGV browser and heatmaps are suitable. Expected file-formats are italicized. Please click here to view a larger version of this figure.
Figure 2: Cortical progenitor culture and DOT1L inhibition. (A) Immunoblots showing H3K79me2 levels in CPC at E14.5 after DOT1L inhibition for 3 days (day 3, n=3-11) in comparison to the DMSO control. H3, GAPDH, and Tubulin alpha were used as loading controls. (B) Immunocytological staining of a CPC culture at days 2 and 3. Activated Caspase 3 (CASP3 green)-positive cells and neurons (HuC/D: red) were stained. DAPI (blue) was used to visualize the cell nuclei. Scale bar: 100 µm. (C) Quantification of the immunostainings presented in (B). The ratio of positive cells for CASP3+/DAPI+ or HuC/D+/DAPI+ in percent is given. For statistical analysis, unpaired Student's t-tests were performed. p<0.01 **. This figure was modified from Roidl et al.33,38 Please click here to view a larger version of this figure.
Figure 3: H3K79me2 ChIP-qPCR of Aft4, Ddit3, Aft3, Scd1, and Npm1 from CPCs treated with DOT1L inhibitor. (A) E14.5-derived CPCs were treated with 5 µM DOT1L inhibitor 4-5 h after isolation and for a second time at day 2 in culture. CPCs were fixed at day 3, which was followed by chromatin extraction, ChIP experiment, and qPCR. Results are represented as the mean (+/-SEM) % input (n=3). IgG was used as a negative control. The mean of the IgG level is depicted as dashed line. For statistical analysis, two-way ANOVA was applied. p<005 *; p<0.01 **, p<0.001 ***; TSS transcriptional start site, TES transcriptional end site. This figure was modified from Roidl et al.33,38 Please click here to view a larger version of this figure.
Figure 4: Overview of H3K79me2 ChIP-seq analysis. (A) Fingerprint of H3K79me2 ChIP-seq from E14.5-derived CPCs compared to input shows an enrichment of DNA fragments for H3K79me2 ensuring a high ChIP-seq quality. (B) H3K79me2 ChIP-seq results plotted in a heatmap. Strongly enriched genomic regions ARE presented in blue. Scaling 0 (dark red) – 45 (dark blue). H3K79me2 peaks near the TSS and declines in the 3´ direction to TES. (C) H3K79me2 ChIP-seq reads were mapped to the mm9 genome and visualized with the integrative genome viewer (IGV). The H3K79me2 occupancy of a gene is displayed as log2 of the number of reads ratio between ChIP and input reads per kilobase per million (Scaling: -10 to 10). Refseq gene structure is represented while a red box indicates the first exon including the TSS. The genes Aft4, Ddit3, Scd1, Aft3, and Npm1 are shown. For comparison, a H3K4me3 signal of the same genomic region is displayed. TSS transcriptional start site, TES transcriptional end site. This figure was modified from Roidl38. Please click here to view a larger version of this figure.
Gene | Region | Primer forward 5'-3' | Primer reverse 5'-3' | ||
Aft4 | TSS | GGACGATCTCTAACGCCACA | GCCCTAAACCCGCCCTTTAT | ||
Aft4 | TSS+1500 | CTCCCGAATATGACATGAACCG | TCCATTCGAAACAGAGCATCG | ||
Aft4 | TES | CCGTAATAGGGTAGTCAGGTGC | AAAGAATGACACTGAAAACCCACA | ||
Ddit3 | TSS | GTACTGGCTCCGTCTAACCC | CAAGAGAGGGCCTGTAAGCA | ||
Ddit3 | TSS+2500 | TCAAGCAGCCGGTCTCATAG | CTCAGATCCCCCAATGGCTT | ||
Ddit3 | TSS+4500 | GAGCTGGAAGCCTGGTATGA | TCACCTCTTCGTTTCCTGGG | ||
Ddit3 | TES | CACCAAGCATGAACAGTGGG | GTACCGTCTATGTGCAAGCC | ||
Aft3 | TSS | AACTGAGAGCGCAACTCCTC | GCTGCCGTTCTTAGCTGGTA | ||
Aft3 | TES | CTGTTGGCACAAAGTGGCTC | GGGATCTGCCATGGTGGAAA | ||
Scd1 | TSS | TAGTGACCACACACAAAAGCTC | CCCAAGTGTAATTTGGATGATTTCC | ||
Npm1 | TSS | TCCCCCTCCAGTCAGTTACC | CGTCCTTTCCTTGGCGTGA | ||
Npm1 | TES | AGGGACATACTTAAGACAAGCCAG | AGGATTGAGGCAGACTGTCAAT | ||
TSS:Transcriptional start site | |||||
TES:Transcriptional end site |
Table 1: List of primers used for ChIP-qPCR.
There are two major ways to perform chromatin immunoprecipitation to detect the genomic occupancy of histone modifications, transcription factors, histone code readers, writers, or erasers. One is the native ChIP method using nuclease digested, native chromatin for immunoprecipitation, and the other is the presented method using PFA-fixed, sheared chromatin, in which the nucleosomes and other DNA-attached proteins are covalently bound to the DNA39. Native ChIP with its high antibody detection rate should be applicable for histone methylation since the chromatin and histone methylations are relatively stable throughout the ChIP. But since a large amount of starting material is needed, it is not applicable for studying cortical or cerebellar development, where the number of cells from mouse brains is usually limited. Although antibodies are generally raised against non-fixed material, we could prove that the antibody specifically detects H3K79me2 since specific inhibition of DOT1L leads to a decreased H3K79me2 signal in ChIP-qPCR analysis and in immunoblots (Figure 2A and Figure 3A). ChIP using cross-linked material might be inefficient, but the presented protocol ensures enough specifically enriched material for qPCR and sequencing analysis.
For an effective ChIP, the SDS concentration of the lysis buffer can be crucial, since SDS denatures proteins and makes them accessible for antibody binding. This feature is especially important for H3K79me2, which is a histone modification located within the globular domain of histone 3 and within the nucleosome core of chromatin's smallest unit22. Thus, for H3K79me2, a higher SDS concentration (approximately 0.3% w/v) during the assay is needed to ensure optimal antigene accessibility. With this SDS concentration, we could highly enrich H3K79me2 over IgG controls (Figure 3) and over input (Figure 4). Thus, the quality of the ChIP-material for sequencing was appropriate and the enrichment over input comparable to that of H3K4me3 (Figure 4). We expect that the same SDS concentration would be needed for ChIP of H3K79 mono or trimethylation mark. In general, the more stringent the ChIP buffer is, the less false-positive chromatin fragments are immunoprecipitated, if the quality of the antibody is not affected by the detergent used. For the future, it might be feasible to apply the presented protocol to other histone modifications within the globular domain of histones.
If the antibodies are suitable for ChIP and are stable at higher detergent concentrations, the protocol mainly contains two critical steps. First, the fixation of the cells and the subsequent shearing of the chromatin should be optimized for each cell type and each ultrasonicator. Prolonged cross-linking leads to fixation artifacts and may reduce the antibody detection rate since antigens may be masked. The chromatin shearing needed to lead a size distribution of the DNA between 200 and 500 bp (Figure 1B). Nucleosomes contain 147 bp of DNA. Chromatin fragments that are too lengthy will lead to false positive results in qPCRs. During genome-wide sequencing, an incorrect size distribution will lead to false negative results, since often only small fragments are considered. The second critical step is the library preparation for genome-wide sequencing. A DNA amplification step needs to be performed using 6-9 PCR-cycles. Avoiding numerous PCR cycles is essential since they may lead to a high GC bias and many PCR duplicates. With the presented protocol, enough DNA can be retrieved to keep the number of necessary PCR cycles low.
Brain tissue consists of a very diverse amount of cell types such as neurons, oligodendrocytes, and glia cells4. During development these cells derive from neural stem cells and build specific areas in the brain in a time- and location-dependent manner3. Neurogenesis of the cerebral cortex, for instance, takes place between E11.5 and E18.5 in mice. At earlier stages such as E11.5 and E12.5 almost all cells have progenitor identity1, but later on cellular diversity needs to be taken into account. Therefore, a ChIP of cortical tissue at E14.5 can reveal H3K79me2 or any other histone modification at that specific time point but cannot display cell-type specific chromatin features. This issue can be solved by enrichment of specific cells with Fluorescence-activated cell sorting (FACS) or Magnetic-activated cell sorting (MaCS-sorting)40, which is feasible after brain homogenization. With MaCS-sorting neural progenitor cells carrying specific cell surface markers can be labeled with magnetic beads and then isolated using a magnetic stand40. Afterwards the cells can be cultured or directly used for ChIP. The presented protocol may be used not only for neural progenitor cells but also for other homogeneous cell populations. With addition of FACS or MaCS, the protocol can be applied for all isolatable cells within an organism.
Taken together, the presented protocol makes it possible to investigate the histone modification H3K79me2 at different time points of cortical and cerebellar development in an efficient and reproducible way. It may be applicable to other histone modifications located within the histone core and can be applied to other homogeneous cell types within the organism. Since H3K79me2 is a conserved histone modification23, the protocol may also be suitable to analyze H3K79me2 not only in mice but across different species.
The authors have nothing to disclose.
We thank Henriette Bertemes for helping to establish the CGN cultivation protocol within the lab. This method paper was supported by the DFG-funded CRC992 Medical Epigenetics by funding to TV. The authors acknowledge the support of the Freiburg Galaxy Team: Pavankumar Videm, Björn Grüning and Prof. Rolf Backofen, Bioinformatics, University of Freiburg, Germany funded by Collaborative Research Centre 992 Medical Epigenetics (DFG grant SFB 992/1 2012) and German Federal Ministry of Education and Research (BMBF grant 031 A538A RBC (de.NBI)).
Anti-GAPDH | Abcam | ab8245 | Category: Antibody Abbreviation/Comment: Immunoblot dilution 1:5000 |
Anti-H3 | Abcam | ab1791 | Category: Antibody Abbreviation/Comment: Immunoblot dilution 1:3000 |
Anti-H3K79me2 | Diagenode | pAb-051-050 | Category: Antibody Abbreviation/Comment: ChIP antibody |
Anti-H3K79me2 | Abcam | ab-051-050 | Category: Antibody Abbreviation/Comment: Immunoblot dilution 1:1000 |
Anti-rabbit-IgG | Diagenode | C15410206 | Category: Antibody Abbreviation/Comment: ChIP Ctrl antibody |
Anti-Tubulin alpha | Abcam | ab108629 | Category: Antibody Abbreviation/Comment: Immunoblot dilution 1:3000 |
Apo-Transferrin (1 mg/ml) | Sigma-Aldrich | T1147 | Category: Cell culture Abbreviation/Comment: For CCM |
B27 Supplement (50x) | Life Technologies | 17504044 | Category: Cell culture Abbreviation/Comment: For CCM |
Bioanalyzer | Agilent technologies | G2940CA | Category: ChIP Abbreviation/Comment: For analysis of sheared chromatin |
Bioruptor NextGen | Diagenode | B01020001 | Category: ChIP Abbreviation/Comment: Ultrasonicator |
Boric acid pH 8.4 | Sigma Aldrich | B6768 | Category: Cell culture Abbreviation/Comment: For CPC culturing |
CFX Connect RT PCR Detection System | Bio-Rad | 1855201 | Category: ChIP Analysis Abbreviation/Comment: Detection system for qPCR |
DMEM-F12 | Life Technologies | 11320-033 | Category: Cell culture Abbreviation/Comment: For CGM |
Dynabeads Protein A | Invitrogen | 10001D | Category: ChIP Abbreviation/Comment: Magnetic beads, for ChIP |
EPZ-5676 | Selleckchem | S7062 | Category: DOT1L inhibition Abbreviation/Comment: For DOT1L inhibition in cell culture |
Ethylenediamine tetraacetic acid | SERVA | 39760.01 | Category: ChIP Abbreviation/Comment: EDTA |
Fetal Bovine Serum 10% (v/v) | Gibco | 10082147 | Category: Cell culture Abbreviation/Comment: For CPC isolation and CGM |
Glucose | Sigma-Aldrich | G5767 | Category: Cell culture Abbreviation/Comment: For CGNP isolation |
Glutathione (1.25 mg/ml) | Sigma-Aldrich | G4251 | Category: Cell culture Abbreviation/Comment: For CCM |
Glycine | Carl Roth | 3187 | Category: ChIP Abbreviation/Comment: For cell fixation |
GoTaq mastermix | Promega | A6002 | Category: ChIP Analysis Abbreviation/Comment: DNA polymerase master mix for qPCR |
Hank’s Balanced Salt Solution | Life Technologies | 14025-100 | Category: Cell culture Abbreviation/Comment: HBSS |
L-glutamine (200 mM) | Life Technologies | 25030081 | Category: Cell culture Abbreviation/Comment: For CCM |
Laminin | Sigma-Aldrich | L2020 | Category: Cell culture Abbreviation/Comment: For CPC culturing |
Lithium chloride | Sigma-Aldrich | L4408 | Category: ChIP Abbreviation/Comment: LiCl |
N2 supplement | Life Technologies | 17502048 | Category: Cell culture Abbreviation/Comment: For CGM |
NanoDrop 3300 | Thermo Fisher | 3300 | Category: ChIP Abbreviation/Comment: Fluorospectrometer for DNA quantification |
NEB Next Ultra DNA Library Prep Kit for Illumina | NEB | E7645S | Category: ChIP Analysis Abbreviation/Comment: Kit for Library preparation |
NEBNext Multiplex Oligos for Illumina | NEB | E7335 | Category: ChIP Analysis Abbreviation/Comment: Oligos for Library preparation |
Neurobasal medium | Gibco | 21103049 | Category: Cell culture Abbreviation/Comment: For CCM |
NP-40 Alternative | Calbiochem | 492016 | Category: ChIP Abbreviation/Comment: For ChIP buffer |
Paraformaldehyde | Carl Roth | 335 | Category: ChIP Abbreviation/Comment: PFA, for cell fixation |
Penicillin-Streptomycin-Neomycin 1% (v/v) | Life Technologies | 15640055 | Category: Cell culture Abbreviation/Comment: PSN, for CCM and CGM |
Phosphate buffered saline | Life Technologies | 10010023 | Category: Cell culture Abbreviation/Comment: PBS, for CPC isolation |
PicoGreen Kit | Thermo Fisher | P11496 | Category: ChIP Analysis Abbreviation/Comment: Visualizing dye for DNA quantification |
Poly-D-lysine | Sigma-Aldrich | P6407 | Category: Cell culture Abbreviation/Comment: For CGNP isolation |
Poly-L-ornithine hydrobromide | Sigma Aldrich | P3655 | Category: Cell culture Abbreviation/Comment: For CPC culturing |
Potassium chloride | Thermo Fisher | AM9640G | Category: Cell culture Abbreviation/Comment: KCl, for CGM |
Protease inhibitor | Roche | 4693159001 | Category: ChIP Abbreviation/Comment: For ChIP |
Proteinase K | Sigma-Aldrich | 3115879001 | Category: ChIP Abbreviation/Comment: For ChIP |
Qiagen MinElute | Qiagen | 28004 | Category: ChIP Abbreviation/Comment: Kit for DNA purification |
RNAse | Sigma-Aldrich | R6513 | Category: ChIP Abbreviation/Comment: For ChIP |
SGC0946 | Selleckchem | S7079 | Category: DOT1L inhibition Abbreviation/Comment: For DOT1L inhibition in cell culture |
Sodium bicarbonate | Carl Roth | 8551.1 | Category: ChIP Abbreviation/Comment: for Elution buffer |
Sodium chloride | Carl Roth | 9265 | Category: ChIP Abbreviation/Comment: NaCl, for ChIP buffer |
Sodium deoxycholate | Sigma-Aldrich | 30970 | Category: ChIP Abbreviation/Comment: For ChIP |
Sodium dodecylsulfate | Carl Roth | 183 | Category: ChIP Abbreviation/Comment: SDS, for ChIP |
Sonic hedgehock (SHH) | Sigma-Aldrich | SRP6004 | Category: Cell culture Abbreviation/Comment: For CGNP isolation |
Superoxide dismutase (1mg/ml) | Sigma-Aldrich | S7571 | Category: Cell culture Abbreviation/Comment: For CCM |
Tris(hydroxymethyl)aminomethane | Carl Roth | 9090 | Category: ChIP Abbreviation/Comment: TRIS, for ChIP buffer |
Triton X-100 | Carl Roth | X100 | Category: ChIP Abbreviation/Comment: For ChIP buffer |
Trypsin-EDTA 0,05% (w/v) | Sigma Aldrich | 59417C | Category: Cell culture Abbreviation/Comment: For CPC isolation |
Tween20 | Carl Roth | 28320 | Category: ChIP Abbreviation/Comment: For bead preparation |
Other Lab devices: Neubauer counting chamber, Incubator, Rotator, Shaker, Disection set, Water bath | |||
CCM: Cortical cell medium | |||
CGM: CGNP cell culture medium |