Introductie van een gen knock-out direct in het Amastigote stadium van Trypanosoma cruzi met behulp van het crispr/Cas9 systeem
Summary
Hier beschrijven we een protocol om een gen knock-out in de extracellulaire amastigote van Trypanosoma cruzi te introduceren, met behulp van het crispr/Cas9-systeem. De groei fenotype kan worden opgevolgd door de celtelling van de Axenische amastigote cultuur of door proliferatie van intracellulaire amastigotes na de invasie van de cel van de host.
Abstract
Trypanosoma cruzi is een pathogene protozoeen parasiet die de ziekte van Chagas voornamelijk in Latijns-Amerika veroorzaakt. Om een nieuwe drug target tegen T. cruzite identificeren, is het belangrijk om de essentialiteit van het doel gen in de zoogdier fase van de parasiet, de amastigote, te valideren. Amastigotes van T. cruzi repliceren in de host-cel; het is dus moeilijk om een knock-out experiment uit te voeren zonder door andere ontwikkelingsstadia te gaan. Onlangs rapporteerde onze groep een groei voorwaarde waarin de amastigote axenisch tot 10 dagen kan repliceren zonder zijn amastigote-achtige eigenschappen te verliezen. Door deze temporale Axenische amastigote cultuur te gebruiken, introduceerden we met succes Grna’s rechtstreeks in het Cas9-uitdrukken van amastigote om genknockouts te veroorzaken en hun fenotypes uitsluitend in de amastigote fase te analyseren. In dit rapport beschrijven we een gedetailleerd protocol om in vitro afgeleide extracellulaire amastigotes te produceren en om de Axenische-cultuur te gebruiken in een CRISPR/Cas9-gemedieerd knock-outexperiment. De groei fenotype van uitblust amastigotes kan worden geëvalueerd hetzij door celtellingen van de Axenische-cultuur, of door replicatie van intracellulaire amastigote na de invasie van de cel van de host. Deze methode omzeilt de parasiet stage differentiatie normaal betrokken bij het produceren van een transgene of een knock-out amastigote. Het gebruik van de temporale Axenische amastigote cultuur heeft het potentieel om de experimentele vrijheid van stage-specifieke studies in T. cruzi uit te breiden.
Introduction
Trypanosoma cruzi is de veroorzaker van de ziekte van Chagas, die overwegend in Latijns-Amerika1voorkomt. T. cruzi heeft kenmerkende levenscyclus stadia tussen een insecten vector en een zoogdier gastheer2. T. cruzi repliceert als een epimastigote in de hepatopancreas van een bloedzuigende triatomine bug en onderscheidt zich in een infectieuze metacyclische trypomastigote in zijn achterhand voordat het wordt afgezet op een menselijke of dierlijke gastheer. Zodra de trypomastigote door de bijt plaats of door een slijmvlies in het gastlichaam komt, valt de parasiet in een holecel en transformeert in een flagella-loze ronde vorm genaamd een amastigote. De amastigote repliceert binnen de ontvangende cel en maakt uiteindelijk onderscheid in trypomastigote, die uit de ontvangende cel uitbarst en de bloedstroom binnenkomt om een andere hostcel te infecteren.
Aangezien momenteel beschikbare chemotherapeutische middelen, benznidazol en Nifurtimox, nadelige bijwerkingen veroorzaken en niet effectief in de chronische fase van de ziekte3, het is van groot belang om te identificeren van de nieuwe drug doelen tegen T. cruzi. In de afgelopen jaren is het CRISPR/Cas9 systeem uitgegroeid tot een krachtig instrument om genen knock-out effectief uit te voeren in T. cruzi, hetzij door transfectie van afzonderlijke of enkelvoudige plasmide (s) die Grna en Cas94bevatten, door stabiele expressie van Cas9 en daaropvolgende introductie van grna5,6,7 of transcriptie sjabloon van grna8, of door elektroporation van het voorgevormde grna/Cas9 RNP complex7,9. Deze technologische vooruitgang is zeer verwacht te versnellen van de drug target onderzoek in de ziekte van Chagas.
Om verder te gaan met de ontwikkeling van geneesmiddelen, is het cruciaal om de essentialiteit van het doel gen of de werkzaamheid van kandidaatstoffen in de amastigote van T. cruzite valideren, omdat het de replicatie fase van de parasiet is in de zoogdier gastheer. Echter, dit is een uitdagende taak, omdat amastigotes kan niet rechtstreeks worden gemanipuleerd als gevolg van de aanwezigheid van een obstructieve host-cel. In Leishmania, een nauw verwante protozoa parasiet tot T. cruzi, een Axenische amastigote kweekmethode werd ontwikkeld en is gebruikt in drug screening testen10,11,12, 13. Hoewel er enkele discrepanties in gevoeligheid voor verbindingen tussen Axenische amastigotes en intracellulaire amastigotes14, het vermogen om de Axenische cultuur te handhaven niettemin biedt waardevolle experimentele instrumenten om te bestuderen van de basis biologie van de klinisch relevante fase van Leishmania15,16. In het geval van T. cruzi, literaturen met betrekking tot de aanwezigheid van natuurlijk voorkomende extracellulaire amastigotes (EA)17 en in vitro productie van EA17,18,19 dateren uit decennia geleden. Daarnaast is het bekend dat EA een besmettelijke capaciteit heeft20, zij het minder dan die van trypomastigote, en het mechanisme van amastigote gastheer invasie is in de afgelopen jaren opgehelderd (beoordeeld door Bonfim-Melo et al.21). Echter, in tegenstelling tot Leishmania, was EA niet gebruikt als een experimenteel hulpmiddel in T. cruzi, vooral omdat EA werd beschouwd als een verplicht intracellulaire parasiet, en dus niet werd beschouwd als “replicatieve vorm” in een praktische Zin.
Onlangs heeft onze fractie voorgesteld om EA van T. cruzi te gebruiken als een temporale Axenische-cultuur22. Amastigotes van T. cruzi tulahuen stam kan repliceren vrij van gastheer cellen in verlicht medium bij 37 ° c voor maximaal 10 dagen zonder ernstige verslechtering of verlies van amastigote-achtige eigenschappen. Tijdens de host-vrije groeiperiode werd EA met succes gebruikt voor exogene genexpressie door conventionele elektroporation, drug titratie assay met trypanocidale verbindingen, en CRISPR/Cas9-gemedieerde Knockout, gevolgd door groei fenotype monitoring. In dit rapport beschrijven we het gedetailleerde protocol om in vitro afgeleide EA te produceren en om de Axenische amastigote in Knockout-experimenten te gebruiken.
Protocol
Representative Results
Discussion
We hebben aangetoond dat de Axenische-cultuur van T. cruzi amastigotes kan worden gebruikt in crispr/Cas9-gemedieerde Gene Knockout, door grna rechtstreeks te elektroporeren in Cas9-UITDRUKKEN van EA. Op deze manier kan de essentialiteit van het doel gen specifiek in amastigote stadium worden geëvalueerd zonder door andere ontwikkelingsstadia te gaan.
Een ander gunstig aspect van amastigote transfectie is het gemak bij het testen van een groot aantal doel genen. Zodra de co-cultuur v…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd deels ondersteund door JSPS KAKENHI Grant nummer 18K15141 tot Y.T.
Materials
| 20% formalin solution | FUJIFILM Wako Pure Chemical | 068-03863 | fixing cells |
| 25 cm2 double seal cap culture flask | AGC Techno Glass | 3100-025 | |
| 75 cm2 double seal cap culture flask | AGC Techno Glass | 3110-075 | |
| All-in One Fluorescence Microscope | Keyence | BZ-X710 | |
| Alt-R CRISPR-Cas9 crRNA (for Control) | IDT | custom made | target sequence = GGACGGCACCTTCATCTACAAGG |
| Alt-R CRISPR-Cas9 crRNA (for TcCGM1) | IDT | custom made | target sequence = TAGCCGCGATGGAGAGTTTATGG |
| Alt-R CRISPR-Cas9 crRNA (for TcPAR1) | IDT | custom made | target sequence = CGTGGAGAACGCCATTGCCACGG |
| Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | to anneal with crRNA |
| Amaxa Nucleofector device | LONZA | AAN-1001 | electroporation |
| Basic Parasite Nucleofector Kit 2 | LONZA | VMI-1021 | electroporation |
| BSA | Sigma-Aldrich | A3294 | component of the medium for in-vitro amastigogenesis |
| Burker-Turk disposable hemocytometer | Watson | 177-212C | cell counting |
| Coster 12-well Clear TC-Treated Multiple Well Plates | Corning | 3513 | |
| DMEM | FUJIFILM Wako Pure Chemical | 044-29765 | culture medium |
| Fetal bovine serum, Defined | Hyclone | SH30070.03 | heat-inactivate before use |
| G-418 Sulfate Solution | FUJIFILM Wako Pure Chemical | 077-06433 | selection of transformant |
| Hemin chloride | Sigma-Aldrich | H-5533 | component of LIT medium |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | staining of nuclei |
| Liver infusion broth, Difco | Becton Dickinson | 226920 | component of LIT medium |
| MES | FUJIFILM Wako Pure Chemical | 349-01623 | component of the medium for in-vitro amastigogenesis |
| PBS (–) | FUJIFILM Wako Pure Chemical | 166-23555 | |
| Propidium Iodide | Sigma-Aldrich | P4864-10ML | staining of dead cells |
| RPMI 1646 | Sigma-Aldrich | R8758 | medium for metacyclogenesis |
References
- World Health Organization. . (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).
- Clayton, J. Chagas disease 101. Nature. 465 (n7301_supp), S4-S5 (2010).
- Apt, W. Current and developing therapeutic agents in the treatment of Chagas disease. Drug Design, Development and Therapy. 4, 243-253 (2010).
- Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. mBio. 6 (4), e01012 (2015).
- Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. mBio. 6 (1), e02097-e02114 (2015).
- Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi. Acta Tropica. 178, 190-195 (2018).
- Burle-Caldas, G. A., Soares-Simões, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants. International Journal for Parasitology. 48 (8), 591-596 (2018).
- Costa, F. C. Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping. PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).
- Soares Medeiros, L. C. High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. mBio. 8 (6), (2017).
- Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. An axenic amastigote system for drug screening. Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).
- Bates, P. A. Axenic culture of Leishmania amastigotes. Parasitology Today. 9 (4), 143-146 (1993).
- Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds. Current Microbiology. 65 (6), 696-700 (2012).
- Nühs, A. Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity. PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).
- De Rycker, M. Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay. Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).
- Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum. Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).
- Pescher, P., Blisnick, T., Bastin, P., Späth, G. F. Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular Microbiology. 13 (7), 978-991 (2011).
- Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi. Experimental Parasitology. 64 (3), 474-484 (1987).
- Pan, S. C. Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C. Experimental Parasitology. 45 (2), 215-224 (1978).
- Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasitology. 110 (05), 547 (1995).
- Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells. Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).
- Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes. Frontiers in Microbiology. 9, 1341 (2018).
- Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi. PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).
- Fernandes, J. F., Castellani, O. Growth characteristics and chemical composition of Trypanosoma cruzi. Experimental Parasitology. 18 (2), 195-202 (1966).
- Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes. Methods in Cell Biology. 93, 21-57 (2009).
- van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research. 20 (11), 2902-2902 (1992).
- Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection. Parasitology International. 66 (3), 236-239 (2017).
- Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3’-untranslated region position-dependent cis-element and an untranslated region-binding protein. The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).
- Shaw, A. K., Kalem, M. C., Zimmer, S. L. Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi. mSphere. 1 (2), (2016).
- Chao, D., Dusanic, D. G. Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography. Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).
- Nogueira, N., Bianco, C., Cohn, Z. Studies on the selective lysis and purification of Trypanosoma cruzi. The Journal of Experimental Medicine. 142 (1), 224-229 (1975).
- Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi. BMC Genomics. 10, 370 (2009).
- Rico, E., Jeacock, L., Kovářová, J., Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Scientific Reports. 8 (1), 7960 (2018).
- Fu, Y. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
- Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
- Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio. 8 (3), e00574-e00617 (2017).
