إدخال الجين بالضربة القاضية مباشرة في مرحلة Amastigote من التريبانوسوما كروزي باستخدام نظام CRISPR/Cas9
Summary
هنا، ونحن نصف بروتوكول لإدخال ضربة قاضية الجينات في amastigote خارج الخلية من التريبانوسوما كروزي، وذلك باستخدام نظام كريسبر / Cas9. ويمكن متابعة النمط الظاهري للنمو إما عن طريق عد الخلايا من ثقافة الماستيغوت الفأس أو عن طريق انتشار الماستيغوت داخل الخلايا بعد غزو الخلية المضيفة.
Abstract
تريبانوسوما كروزي هو طفيلي بروتوزوان المسبب للأمراض الذي يسبب مرض شاغاس بشكل رئيسي في أمريكا اللاتينية. من أجل تحديد هدف جديد للمخدرات ضد T. cruzi، من المهم التحقق من صحة ضرورة الجينات المستهدفة في مرحلة الثدييات من الطفيلي ، وamastigote. Amastigotes من T. كروزي تكرار داخل الخلية المضيفة; وبالتالي، فإنه من الصعب إجراء تجربة خروج المغلوب دون الذهاب من خلال مراحل التنمية الأخرى. في الآونة الأخيرة، أبلغت مجموعتنا عن حالة نمو يمكن فيها للamastigote تكرار axenically لمدة تصل إلى 10 أيام دون أن تفقد خصائصها الشبيهة بamastigote. باستخدام هذه الثقافة amastigote axenic الزمنية، قدمنا بنجاح gRNAs مباشرة في Amastigote Cas9 التعبير عن التسبب في خروج المغلوب الجينات وتحليل الأنماط الظاهرية الخاصة بهم حصرا في مرحلة amastigote. في هذا التقرير، نقوم بوصف بروتوكول مفصل لإنتاج في المختبر المستمدة من الماستيغوت، والاستفادة من ثقافة الفأس في تجربة خروج المغلوب كريسبر / Cas9 بوساطة. يمكن تقييم النمط الظاهري للنمو من amastigotes بالضربة القاضية إما عن طريق عدد الخلايا من الثقافة axenic، أو عن طريق النسخ المتماثل من amastigote داخل الخلايا بعد غزو الخلية المضيفة. هذا الأسلوب يتجاوز التمايز مرحلة الطفيلي تشارك عادة في إنتاج amastigote المعدلة وراثيا أو بالضربة القاضية. استخدام ثقافة الماستيغوت الفأس الزمنية لديه القدرة على توسيع الحرية التجريبية للدراسات الخاصة بمرحلة محددة في T. cruzi.
Introduction
تريبانوسوما كروزي هو العامل المسبب لمرض شاغاس ، والذي ينتشر بشكل رئيسي في أمريكا اللاتينية1. T. كروزي لديه مراحل دورة حياة مميزة كما أنه يسافر بين ناقلات الحشرات ومضيف الثدييات2. T. كروزي يكرر كما الظهارة في midgut من علة ترياتوميمين مص الدم ويميز في trypomastigote المعدية في الجزء الخلفي قبل أن تودع على الإنسان أو الحيوان المضيف. مرة واحدة في trypomastigote يحصل في الجسم المضيف من خلال موقع لدغة أو من خلال غشاء المخاطية، والطفيلي يغزو خلية المضيف ويتحول إلى شكل جولة فلاجيلا أقل تسمى amastigote. ينسخ ال [أمستجوت] داخل المضيفة خلية و [إينرتيم] أخيرا يميّز داخل [تريبومستغوت], أيّ ينفجر من المضيفة خلية ويدخل الدم مجرى أن يصيب آخر مضيفة خلية.
منذ وكلاء العلاج الكيميائي المتاحة حاليا, benznidazole وnifurtimox, تسبب الآثار الجانبية السلبية وغير فعالة في المرحلة المزمنة من المرض3, فمن مصلحة كبيرة لتحديد أهداف المخدرات جديدة ضد T. كروزي. في السنوات الأخيرة، أصبح نظام CRISPR/Cas9 أداة قوية لأداء الجينات بالضربة القاضية بشكل فعال في T. cruzi، إما عن طريق نقل بلازميد منفصل أو واحد يحتوي على gRNA و Cas94، من خلال التعبير المستقر عن Cas9 واللاحقة إدخال gRNA5،6،7 أو قالب النسخ من gRNA8،أو عن طريق الكهربائي من مجمع gRNA /Cas9 RNP شكلت مسبقا7،9. ومن المتوقع إلى حد كبير أن يسرع هذا التقدم التكنولوجي في البحوث التي تستهدف المخدرات في مرض شاغاس.
للمضي قدما في تطوير المخدرات ، من الأهمية بمكان التحقق من أهمية الجين المستهدف أو فعالية المركبات المرشحة للأدوية في amastigote T. cruzi، كما هو مرحلة النسخ المتماثل للطفيلي في المضيف الثدييات. ومع ذلك، هذه مهمة صعبة، لأنه لا يمكن التلاعب بـ amastigotes مباشرة بسبب وجود خلية مضيف معرقلة. في ليشمانيا، وهو طفيلي بروتوزوان وثيق الصلة إلى T. cruzi، تم تطوير طريقة زراعة الماستيجوت الفأسية واستخدمت في فحص المخدرات الاختبارات10،11،12، 13.على الرغم من أن هناك بعض الاختلافات في قابلية المركبات بين الماستيغوتات الفأسوية وamastigotes داخل الخلايا14،والقدرة على الحفاظ على ثقافة الفأس مع ذلك يوفر أدوات تجريبية قيمة لدراسة البيولوجيا الأساسية للمرحلة ذات الصلة سريريا من الليشمانيا15،16. في حالة T. كروزي، والآداب فيما يتعلق بوجود amastigotes خارج الخلية التي تحدث بشكل طبيعي (EA)17 وفي إنتاج المختبر من EA17،18،19 يعود تاريخها إلى منذ عقود. وبالإضافة إلى ذلك، من المعروف أن EA لديها قدرة معدية20، وإن كان أقل من ذلك من trypomastigote، وقد تم توضيح آلية غزو المضيف amastigote في السنوات الأخيرة (استعرض من قبل Bonfim-Melo وآخرون21). ومع ذلك، على عكس ليشمانيا، لم يتم استخدام EA كأداة تجريبية في T. cruzi، ويرجع ذلك في المقام الأول إلى أن EA كان يعتبر طفيلي داخل الخلايا ملزمة ، وبالتالي لم يكن يعتبر “شكل التكرار” في عملية معني.
في الآونة الأخيرة، اقترحت مجموعتنا للاستفادة من EA من T. كروزي كثقافة axenic الزمنية22. Amastigotes من سلالة T. كروزي تولاهوين يمكن تكرار خالية من الخلايا المضيفة في وسط LIT في 37 درجة مئوية لمدة تصل إلى 10 أيام دون تدهور كبير أو فقدان خصائص تشبه amastigote. خلال فترة النمو الخالية من المضيف، تم استخدام EA بنجاح للتعبير الجيني الخارجي عن طريق الكهربة التقليدية، وفحص معايرة المخدرات مع مركبات التربانوسيدال، وخروج المغلوب كريسبر/كاس9 بوساطة تليها رصد النمط الظاهري للنمو. في هذا التقرير، ونحن نصف البروتوكول التفصيلي لإنتاج في المختبر المستمدة EA واستخدام amastigote axenic في تجارب خروج المغلوب.
Protocol
Representative Results
Discussion
لقد أثبتنا أن الثقافة الفأسية لـ T. cruzi amastigotes يمكن استخدامها في ضربة قاضية للجين كريسبر/كاس9 بوساطة، وذلك عن طريق الكهربائي gRNA مباشرة إلى Cas9-التعبير عن EA. وبهذه الطريقة، يمكن تقييم ضرورة الجين المستهدف على وجه التحديد في مرحلة الماستيغوت دون المرور بمراحل تنموية أخرى.
ج?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
وقد تم دعم هذا العمل جزئيا من قبل JSPS KAKENHI منحة رقم 18K15141 إلى Y.T.
Materials
| 20% formalin solution | FUJIFILM Wako Pure Chemical | 068-03863 | fixing cells |
| 25 cm2 double seal cap culture flask | AGC Techno Glass | 3100-025 | |
| 75 cm2 double seal cap culture flask | AGC Techno Glass | 3110-075 | |
| All-in One Fluorescence Microscope | Keyence | BZ-X710 | |
| Alt-R CRISPR-Cas9 crRNA (for Control) | IDT | custom made | target sequence = GGACGGCACCTTCATCTACAAGG |
| Alt-R CRISPR-Cas9 crRNA (for TcCGM1) | IDT | custom made | target sequence = TAGCCGCGATGGAGAGTTTATGG |
| Alt-R CRISPR-Cas9 crRNA (for TcPAR1) | IDT | custom made | target sequence = CGTGGAGAACGCCATTGCCACGG |
| Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | to anneal with crRNA |
| Amaxa Nucleofector device | LONZA | AAN-1001 | electroporation |
| Basic Parasite Nucleofector Kit 2 | LONZA | VMI-1021 | electroporation |
| BSA | Sigma-Aldrich | A3294 | component of the medium for in-vitro amastigogenesis |
| Burker-Turk disposable hemocytometer | Watson | 177-212C | cell counting |
| Coster 12-well Clear TC-Treated Multiple Well Plates | Corning | 3513 | |
| DMEM | FUJIFILM Wako Pure Chemical | 044-29765 | culture medium |
| Fetal bovine serum, Defined | Hyclone | SH30070.03 | heat-inactivate before use |
| G-418 Sulfate Solution | FUJIFILM Wako Pure Chemical | 077-06433 | selection of transformant |
| Hemin chloride | Sigma-Aldrich | H-5533 | component of LIT medium |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | staining of nuclei |
| Liver infusion broth, Difco | Becton Dickinson | 226920 | component of LIT medium |
| MES | FUJIFILM Wako Pure Chemical | 349-01623 | component of the medium for in-vitro amastigogenesis |
| PBS (–) | FUJIFILM Wako Pure Chemical | 166-23555 | |
| Propidium Iodide | Sigma-Aldrich | P4864-10ML | staining of dead cells |
| RPMI 1646 | Sigma-Aldrich | R8758 | medium for metacyclogenesis |
References
- World Health Organization. . (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).
- Clayton, J. Chagas disease 101. Nature. 465 (n7301_supp), S4-S5 (2010).
- Apt, W. Current and developing therapeutic agents in the treatment of Chagas disease. Drug Design, Development and Therapy. 4, 243-253 (2010).
- Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. mBio. 6 (4), e01012 (2015).
- Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. mBio. 6 (1), e02097-e02114 (2015).
- Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi. Acta Tropica. 178, 190-195 (2018).
- Burle-Caldas, G. A., Soares-Simões, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants. International Journal for Parasitology. 48 (8), 591-596 (2018).
- Costa, F. C. Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping. PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).
- Soares Medeiros, L. C. High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. mBio. 8 (6), (2017).
- Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. An axenic amastigote system for drug screening. Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).
- Bates, P. A. Axenic culture of Leishmania amastigotes. Parasitology Today. 9 (4), 143-146 (1993).
- Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds. Current Microbiology. 65 (6), 696-700 (2012).
- Nühs, A. Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity. PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).
- De Rycker, M. Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay. Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).
- Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum. Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).
- Pescher, P., Blisnick, T., Bastin, P., Späth, G. F. Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular Microbiology. 13 (7), 978-991 (2011).
- Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi. Experimental Parasitology. 64 (3), 474-484 (1987).
- Pan, S. C. Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C. Experimental Parasitology. 45 (2), 215-224 (1978).
- Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasitology. 110 (05), 547 (1995).
- Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells. Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).
- Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes. Frontiers in Microbiology. 9, 1341 (2018).
- Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi. PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).
- Fernandes, J. F., Castellani, O. Growth characteristics and chemical composition of Trypanosoma cruzi. Experimental Parasitology. 18 (2), 195-202 (1966).
- Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes. Methods in Cell Biology. 93, 21-57 (2009).
- van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research. 20 (11), 2902-2902 (1992).
- Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection. Parasitology International. 66 (3), 236-239 (2017).
- Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3’-untranslated region position-dependent cis-element and an untranslated region-binding protein. The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).
- Shaw, A. K., Kalem, M. C., Zimmer, S. L. Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi. mSphere. 1 (2), (2016).
- Chao, D., Dusanic, D. G. Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography. Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).
- Nogueira, N., Bianco, C., Cohn, Z. Studies on the selective lysis and purification of Trypanosoma cruzi. The Journal of Experimental Medicine. 142 (1), 224-229 (1975).
- Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi. BMC Genomics. 10, 370 (2009).
- Rico, E., Jeacock, L., Kovářová, J., Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Scientific Reports. 8 (1), 7960 (2018).
- Fu, Y. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
- Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
- Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio. 8 (3), e00574-e00617 (2017).
