Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

1. Expression of FAHD proteins in competent E. coli

1. Transformation of E. Coli with vectors for expression of FAHD protein
   NOTE: The steps discussed in the following section are summarized in the sketch in Figure 1A,B. The same protocol applies for any FAHD protein, including point-mutant variants. Such variants may be obtained via site-directed mutagenesis and PCR techniques¹⁹ (such as two-sided SOE PCR²⁰) from wild-type cDNA.
   
   Figure 1: Amplification of competent E. coli and induction of protein expression.
   (A) Insertion of the pET vector into competent BL21(DE3) pLysS E. coli bacteria, described in section 1. (B) Heat shock protocol and plating of the pET transformed E. coli bacteria, described in step 1 of the protocol. Transformed bacteria are plated on LB agar plates with antibiotics for selection. (C) Amplification of pET transformed E. coli bacteria, described in section 1. Colonies are picked from an LB agar plate and amplified in nourishing medium (LB or NZCYM) until the bacterial density reached the empirical threshold of 0.4. (D) Induction of protein expression via the DE3-IPTG-pET system, described in section 1 and sketched in Figure 2. Protein production is started by the application of the chemical IPTG. At the end of section 1, the bacterial pellet containing the protein is harvested. Please click here to view a larger version of this figure.
   1. Obtain competent BL21(DE3) pLysS E. coli bacteria and a pET expression vector (see Table of Materials). Preferably choose a pET vector that also encodes an N-terminal His-tag or related capture tag for convenience to simplify the following purification steps.
   2. Obtain cDNA of the FAHD protein of choice and insert it into the active cloning site of the pET expression vector, in between the T7 promoter and T7 terminator sites, respectively.
   3. After successful plasmid amplification and verification [via sequencing by a commercial supplier (T7 primers may be used with the pET system for convenience: T7 promoter, forward primer: TAATACGACTCACTATAGGG; T7 terminator, reverse primer: GCTAGTTATTGCTCAGCGG)], insert 5–10 ng of plasmid into 100 µL of competent BL21(DE3) pLysS E. coli bacteria on ice. Do not aspirate up and down, but slightly tap the tube with in order to mix the content.
   4. Keep the bacteria on ice for 30 min, gently tapping the tube every few min.
   5. Heat a heating device or water bath to 42 °C (exact). Put the tube containing the bacteria into the apparatus and keep them for 90 s (exact). Put them on ice immediately (Figure 1A).
   6. After 5–10 min on ice, add 600 µL of NCZYM medium (see Table of Materials) and put the tube into a bacteria incubator. Shake the tube at medium speed oriented along the shaking direction at 37 °C for 1 h.
   7. Plate 200 µL of the bacterial culture on a 10 cm LB-agar plate (see Table of Materials), containing selection antibiotics of choice [e.g., one specific for the BL21(DE3) pLysS resistance (chloramphenicol), and one for the resistance encoded on the pET vector (kanamycin or ampicillin, Figure 1B)].
   8. Culture the bacteria on the LB-agar plate in a bacterial incubator at 37 °C overnight.
2. Expression of FAHD proteins by IPTG induction
   NOTE: The first steps discussed in the following section are summarized as a sketch in Figure 1C,D. The T7 expression system via combination of the bacterial DE3 cassette and pET vector system are summarized in Figure 2.
   
   Figure 2: The DE3 cassette/pET vector dual system explained.
   (A) The sketched genome of pET vector transformed BL21(DE3) pLysS E. coli bacteria. The native bacterial genome carries a DE3 cassette (see panel B), as well as a lac gene that constantly expresses lac repressor units. The non-native pET vector carries the protein gene inserted between a T7 polymerase promoter and terminator sequence. More details in panel B. (B) The DE3 cassette of the native bacterial genome encodes the information for T7 polymerase in terms of an E. coli RNA polymerase operon. This protein, however, is not expressed because the lac repressor unit prevents the RNA polymerase protein from binding. Hence no T7 polymerase is expressed and no exogenous protein is expressed. (C) Application of the chemical IPTG (Table of Materials) distorts the structure of lac repressor units and prevents them from binding to the DE3 cassette. As a result, RNA polymerase can now bind to the cassette, for which T7 polymerase is expressed, as is exogenous protein eventually. Please click here to view a larger version of this figure.
   1. After successful colony formation, pick one single colony (without any satellite colonies) and disperse it in 5 mL of NZCYM or LB medium with antibiotics, selected as before (step 1.1.7). Culture in the bacterial incubator at 37 °C overnight (Figure 1C).
   2. After successful bacterial growth, amplify the bacteria in 250 mL, 500 mL, or 1 L batches of medium, depending on the demand of protein quantity.
      1. Appropriate to the volume, apply antibiotics selected as done in step 1.1.7 and add about 1%–2% of dense bacterial pre-culture (i.e., 2.5–5.0 mL to 250 mL volume of medium, etc.). Take a sample to be used in step 1.2.5 (1 mL or more) and check the optical density (OD) at 600 nm. Culture bacteria in the bacterial incubator at 37 °C for 2–3 h (Figure 1C).
   3. After 2–3 h, draw a sample for photometric analysis. If the OD at 600 nm has reached 0.4, apply 200 µM up to 1 mM isopropyl-β-D-thiogalactopyranosid (IPTG, see Table of Materials).
      NOTE: The actual value is empirical for each FAHD protein or point mutation variant, where 1 mM IPTG is the maximum that should be applied. This induces protein expression (Figure 1D, Figure 2C).
   4. After 3–5 more hours in the bacterial incubator at 37 °C, protein expression is exhausted.
      NOTE: See the discussion section for comments on temperature control. Longer than 5 h of shaking after induction is not recommended. Take a sample for use in step 1.2.5 (1 mL or more) and check the optical density (OD) at 600 nm.
      1. Harvest the bacterial pellet via centrifugation at 5,000 x g for 5 min. Discard the supernatant and freeze the pellet at -80 °C for longer storage or -20 °C for brief storage (Figure 1D).
   5. Verify induction via the two retrieved photometric samples, that are labelled “-I” (before induction) and “+I” (after induction). After centrifugation and resuspension of the bacterial pellet, analyze the two samples by SDS-PAGE by loading the same amount of total protein.
      NOTE: The “+I” sample should display a strong band associated with the molecular weight of the chosen protein, whereas the “-I” sample should not contain this band. A low induction level is a common problem for production of proteins, yet the level of expressed protein is often sufficient for the following steps. A high induction level is an advantage but is not mandatory.

2. Lysis of bacterial pellets and filtration of debris

1. Dependent on whether the chosen protein is His-tagged or untagged, select Ni-NTA running buffer (His-tagged, see Table of Materials) or ice-cold HIC running buffer (untagged).
2. For each 250 mL of original bacterial suspension, apply 5 mL of the selected buffer to the bacterial pellet (5 mL for 250 mL, 10 mL for 500 mL, etc.). Add 10 µL β-mercaptoethanol (β-ME) per 5 mL of applied buffer. Use a 10 mL Pasteur pipet to mechanically force the pellet into suspension by scratching and pipetting (avoid air bubble formation while pipetting). Eventually transfer all of the suspension into one 50 mL tube.
3. Preferably sonicate (6x for 15 s at medium force) the suspension.
4. Centrifuge for 30 min at high speed (10,000 x g) at 4 °C. Filter the supernatant consecutively with filter units (e.g., 0.45 µm, 0.22 µm) on ice.
   NOTE: Depending on the previous centrifugation step, filtration directly through a small filter pore size may be tedious and usually requires pre-filtration through a larger pore size. DNAse may be added for better results.
5. Store the sample on ice and proceed immediately with either section 3 or 4, depending on whether the protein is His-tagged or untagged.

3. Purification of His-tagged FAHD proteins using Ni-NTA affinity chromatography

NOTE: Ni²⁺ ions are bound via nitrilotriacetic acid (NTA) to an agarose resin that is used in affinity chromatography (immobilized metal ion chromatography, IMAC, Figure 3A). Poly-histidine amino acid tags bind strongly to this Ni-chelate, and His-tagged proteins can be separated from the majority of remaining proteins. An alternative to the described preparation of Ni-NTA columns is using prepacked Ni-NTA columns and a FPLC system.

Figure 3: Sketched illustrations of common types of chromatography.
(A) The resin of a Ni-NTA column. NTA holds bivalent nickel ions that are used in terms of immobilized metal ion affinity chromatography (IMAC). Poly-histidine tags bind preferably to this motif and may be eluted by imidazole. (B) The typical coating of silica particles in a phenyl-based hydrophobic interaction chromatography (HIC-phenyl). Hydrophobic proteins interact with the coating material and are delayed in their migration while others are not. (C) The typical coating of silica particles in ionic interaction chromatography. Polarized and charged proteins interact with the coating material and are delayed in their migration while others are not. (D) The resin of a silica gel in size-exclusion chromatography (SEC). Based on defined pores in the silica material, proteins may be separated by their size (in a first approximation corresponding to their molecular mass). Small proteins permeate the porous column material and are retarded, while large proteins migrate faster around the porous particles. Please click here to view a larger version of this figure.

1. Proceed from step 2.5 (i.e., the protein is in Ni-NTA running buffer and filtered by 0.22 µm filter units on ice).
2. Prepare an empty plastic or glass column by washing the empty column and attaching it to a stable retainer. Choose the size of the column depending on the volume of the protein suspension.
3. For each 10 mL of protein suspension, apply 500 µL of Ni-NTA agarose slurry into the column (shake heavily before usage). Apply the slurry slowly and dropwise onto the bottom filter of the column using a pipette. Let the column settle, which takes a few seconds.
4. Fill the column completely with Ni-NTA running buffer, ensuring not to disrupt the agarose resin. Let the buffer run through by gravity. The process may be accelerated up by applying thumb pressure onto the liquid (using a lid or glove and thumb pressure), but take care not to distort the agarose resin.
5. Apply the protein suspension. As before, let the sample run through by gravity. Accelerating this step using thumb pressure is not recommended, as binding of proteins to the column is enhanced if the flow rate is low. Collect the flow-through in a tube (Table of Materials).
6. After the sample has passed through, fill the whole column again with Ni-NTA running buffer. Take care to not disrupt the agarose resin. Let the sample run through by gravity, but in contrast to the previous step, accelerating the process via thumb pressure is recommended, as potential contaminations because of unspecific interactions may be disrupted this way. Collect the washing solution in a tube. Repeat this step.
7. Place a UV-transparent cuvette below the column and apply 1 mL of Ni-NTA elution buffer. Collect the sample without applying any thumb pressure to the resin.
8. Check the optical density (OD) of the sample at 280 nm vs. a blank sample (i.e., Ni-NTA elution buffer). Optimally, the sample displays an OD of greater than 2.5. An OD below 0.5 denotes that no significant amount of protein is in the sample.
   NOTE: As outlined in the discussion section, salt and imidazole concentrations of the elution buffer may have to be adapted for each FAHD protein individually.
9. Repeat steps 3.1.7 and 3.1.8 until the OD falls below 0.5. Pool all samples with higher OD in a tube on ice.
10. Start again with step 3.1.4, using the flow-through from step 3.1.5 as new input for this repetition of step 3.1.5. Repeat this process until the first sample collected in step 3.1.6 displays an OD below 0.5.
    NOTE: As outlined in the troubleshooting part of the discussion section, His-tagged proteins may bind insufficiently to the Ni²⁺-resin. In such cases, repetition of this step or alternative methods (e.g., ion exchange chromatography) are required.
11. Take samples of all intermediate fractions for SDS-PAGE analysis.
12. FAHD proteins in Ni-NTA elution buffer will precipitate upon freezing and thawing. Therefore, dialyze the protein against a different buffer (overnight on ice, using 1 µL of DTT per 100 mL of dialysis buffer). Use low-salt buffer based on which type of ion-exchange chromatography should be performed after this step. Use common cellulose tubing with a typical molecular weight cut-off of 14 kDa (Table of Materials).
13. After overnight dialysis, optionally concentrate the protein using ultra-centrifugation filter units. Perform SDS-PAGE analysis (12.5% running gel, 4% stacking gel) to check for potential loss of protein, insufficient elution, and protein purity in general. If all is fine, proceed to section 5.

4. Purification of untagged FAHD proteins via hydrophobic interaction chromatography (HIC)

NOTE: Phenyl-groups on the coating surface of a silica gel in a HIC column for FPLC (Figure 3B) enable the separation of proteins according to hydrophobic character. The described steps should be performed with an FPLC system equipped with a 5 mL of HIC-phenyl column. Columns may be washed with 1 M NaOH to be reused for different proteins. However, columns once used for one type of FAHD protein should be reused for only this type of protein.

1. Ammonium sulfate (AS) precipitation
   1. Proceed from step 2.5. The protein is in ice-cold HIC running buffer (Table of Materials).
   2. Assess the volume of the prepared protein solution precisely to the microliter (V_initial). Slowly and drop-wise add pre-cooled HIC running buffer AS solution, until a 35 volume-% AS saturation is reached: V_AS added = V_initial * 0.538. Gently stir the solution for 30 min. Centrifuge for 15 min at high speed (≥10,000 x g) at 4 °C.
   3. Filter the supernatant using a 0.22 µm filter unit on ice. Optionally, take a sample for SDS-PAGE analysis: dilute 1:4 and heat immediately at 95 °C for 5 min or else the sample will lump. The sample may be frozen at this point (-20 °C) in order to proceed another day.
2. FPLC using a HIC column
   1. Setup the FPLC system and equilibrate a 5mL HIC-phenyl column with 5 column volumes (CV) of 20% EtOH (in H₂O) followed by 5 CV of H₂O.
   2. Mix 260 mL of HIC running buffer (exact) with 140 mL of HIC running buffer AS (exact). This results in a 35 volume-% AS solution. Check the pH (7.0); this is buffer A. Buffer B is 250 mL of running buffer. Add 1 mM DTT to both buffers A and B, then keep them on ice.
   3. Equilibrate the column with 8 mL of buffer A, 8 mL of buffer B, and 8 mL of buffer A in this sequence. Apply the sample prepared in protocol step 4.1. Wash with buffer A, until the baseline optical absorption at 280 nm reaches 1000–500 mAU.
   4. Apply a mixture of buffers A and B, so that the concentration of AS is 33 % (w/v). Wash with 1 CV, resulting in a plateau in the chromatogram. Set up a gradient of buffer B (up to 100% buffer B over time): 1.5 mL of buffer B in 3.8 min (i.e., 5.7% buffer B with 1% B/mL slope). When the UV signal at 280 nm rises, start collecting the fraction and place it on ice immediately.
   5. In the end, wash the column with buffer B. Take samples of all fractions for SDS-PAGE analysis. Freeze all samples using liquid nitrogen, and store them at -80 °C.
   6. Perform SDS-PAGE (and western blot) analysis, to detect the FAHD protein in the collected fractions. Fractions that contain the protein are pooled and applied to further purification, as outlined in the following protocol steps. Wash the column with H₂O and 20% EtOH (in H₂O).

5. Purification of FAHD proteins via ion exchange chromatography

NOTE: Molecules with charged functional groups are bound to a silica particle column for FPLC (Figure 3C). This enables the differentiation of proteins according to their ionic character, such as surface charge. The described steps should be performed with an FPLC machine and associated know-how, respectively. The described method is the same for either cationic or anionic exchange chromatography, but the buffers to be used are slightly different.

1. Chose the cationic or anionic exchange chromatography system. This choice is empirical and may vary among FAHD proteins. Optimally, both methods can be used consecutively.
2. Setup the FPLC system and wash the column with 5 CV of 20% EtOH (in H₂O), followed by 5 CV of H₂O. Equilibrate the column with 1 CV of low-salt buffer, high-salt buffer, and again low-salt buffer in this sequence.
3. Apply the sample (dialyzed against the correct low salt buffer from step 3.1.11) onto the column. Collect the flow-through. Wash the column for 1 CV with low salt buffer.
4. Setup a gradient elution: 100% high-salt buffer in 30 min at a flow rate of 1 mL/min, or 60 min at a flow rate of 0.5 mL/min. This may be re-selected based on an already known FPLC chromatogram, in order to optimize the purification. Collect all peak fractions.
   NOTE: High-salt conditions may vary among FAHD proteins, as outlined in the discussion section.
5. After the gradient has finished, run with high-salt buffer until no more peaks are detected over the range of 1 CV (collect the fractions).
6. Take samples of all collected fractions and perform SDS-PAGE analysis (12.5% running gel, 4% stacking gel). Freeze the individual samples in liquid nitrogen and store them at -80 °C.
7. After SDS-PAGE analysis is complete, pool the samples containing the FAHD protein and discard the others. Optionally, concentrate the protein using ultra-centrifugation filter units.
8. Apply 1 mL of 25% SDS in 0.5 M NaOH (or other detergents) to clean the column. Wash the column with H₂O and 20% EtOH (in H₂O).
9. Optionally, repeat section 5 with the alternate column (cationic or anionic exchange chromatography). The protein obtained from this method is sufficiently pure to perform basic activity assays or can be used in screening assays for crystallography. For advanced applications, proceed with section 6.

6. Purification of FAHD proteins via size-exclusion chromatography (SEC)

NOTE: Porous particles in a silica gel column for FPLC enable the differentiation of proteins according to molecular size, such as hydrodynamic radius (Figure 3D). The described steps are to be performed with an FPLC system, using SEC columns.

1. Choose an SEC column, dependent on the molecular weights of contaminations still present, as detected via SDS-PAGE and silver staining. The outlined method is suitable for both columns. Wash the column overnight with 400 mL of H₂O and equilibrate with SEC running buffer. It is recommended to write a program for the FPLC system to automate this step.
2. Add 1 mM DTT to 300 mL of SEC running buffer and put it on ice. This is the running buffer. Apply 60 mL of this buffer to the column.
3. Centrifuge the protein sample (10,000 x g for 10 min) to remove any micro-precipitation. Apply the supernatant to the column. It is generally recommended to filter the supernatant before FPLC.
4. Apply the running buffer to the column until all protein is eluted. Collect all peaks in fractions of suitable volume (e.g., 2 mL). Take samples for SDS-PAGE and freeze all fractions using liquid nitrogen. Store the frozen fractions at -80 °C.
5. After SDS-PAGE (and western blot) analysis, collect and pool all fractions containing the FAHD protein. Silver staining is recommended to detect minor contaminations that may still be present.
6. Use ultra-centrifugation filter units in order to concentrate the protein. Although not mandatory for FAHD proteins, in general a desalting step (e.g., by dialysis) is recommended for enzyme assays and crystallization.
7. Repeat steps 6.3–6.6 several times with different flow rates and salt concentrations (empirical) in order to enhance the purity of the FAHD protein. Wash the column overnight with H₂O and 20% EtOH (in H₂O).

7. Basic FAHD activity assays with substrates oxaloacetate and acetylpyruvate

NOTE: FAHD protein 1 (FAHD1) displays oxaloacetate decarboxylase (ODx) and acylpyruvate hydrolase (ApH) activity. This is outlined in more detail in the discussion section. Because of destabilization by keto-enol tautomerization in aqueous solution (i.e., enolization), oxaloacetate decays by itself over time (auto-decarboxylation) as a function of cofactor concentration and pH. At around a pH of 7 and temperature of 25 °C, this effect is not dramatic, but assays must be blanked to account for both auto-decarboxylation and enzyme concentration. The pipetting scheme is outlined in Figure 4A. In general, it is recommended to use well calibrated pipettes for this assay, as it is quite sensitive to minor pipetting errors.

Figure 4: Sketched pipetting scheme for enzyme assays.
(A) A sketched pipetting scheme for basic substrate-based FAHD protein enzyme assays. Substrate blank: -S/-E; substrate sample: +S/-E; enzyme blank: -S/+E; enzyme sample: +S/+E (S: substrate, E: enzyme). See protocol step 7 for more details. (B) A sketched pipetting scheme for assessing Michaelis-Menten kinetics of FAHD protein. Substrate blank: -S/-E; substrate sample: +S/-E; enzyme blank: -S/+E; enzyme sample: +S/+E (S: substrate, E: enzyme). See section 8 of the protocol for more details. Please click here to view a larger version of this figure.

1. Start up a microplate reader and equilibrate for 30 min at 25 °C. Setup a program for reading 12 wells (as outlined in Figure 4A) at 255 nm. It is recommended to use 25 multiple readouts with 5 ms time delay. Setup a cycle to measure 15x every 2 min (30 min total).
2. By default, prepare an enzyme assay buffer (see Table of Materials) with 1 mM MgCl₂ at pH 7.4. Variant FAHD proteins may require different cofactors or pH levels. Mg²⁺ and Mn²⁺ are known cofactors for FAHD1^3,11,12,21.
3. Create a 1 µg/µL protein solution, diluting with enzyme assay buffer (Table of Materials).
4. Set up 1 mL of 20 mM solution of a substrate to be tested (so far identified substrates of FAHD proteins are listed elsewhere³) in enzyme assay buffer.
5. According to the pipetting scheme displayed in Figure 4A, prepare the enzyme blank and sample wells: pipet 90 µL of enzyme assay buffer (Table of Materials) into the wells with 5 µL (5 µg) of enzyme solution.
6. According to the pipetting scheme displayed in Figure 4A, prepare the substrate blank and sample wells: pipet 95 µL of enzyme assay buffer into the wells.
7. Right before measuring, apply 5 µL of enzyme assay buffer into the six blank wells. Apply 5 µL of the 20 mM substrate solution to the sample wells. It is recommended to use a multichannel pipette.
8. Use a multichannel pipette at 50 µL settings to gently mix all wells. Start with the blanks and proceed with the sample wells. Take care not to create any bubbles. Insert the plate into a microplate reader and measure each well at 255 nm (as outlined in step 7.1).
9. Perform the analysis in a spreadsheet. Copy the raw data from the photometer into a spreadsheet, and write all settings (i.e., all documentation) into another sheet. Average the data of the three wells of each of the four preparations. Subtract the blank from the sample. Also compute standard deviations and sum the deviations of blank and sample.
10. Plot this data (y: optical density, x: time in min). An exponentially decreasing curve should be displayed. Dependent on the kind of substrate in use, an initial increase within the first 10 min may be observed, after which the signal decreases. This is ascribed to the keto-enol tautomerization of the substrate, as outlined in more detail in the discussion section.
11. Divide the optical signal data over time by the maximum value of the plot, in order to scale the data down into the range [0, 1] (an example is provided in Figure 5A). Identify the linear range of the curve, starting at the initial decrease, and compute the negative slope (1/min).
12. The time course of the decrease in OD is associated to the substrate via its initial concentration: 100 nmol/well * slope. Using the assessed protein concentration c_0, the specific activity is computed: 100 nmol/well * slope * 1/c₀. Expressing c₀ in µg/well, the specific activity computed this way is expressed using the unit nmol/min/µg, which equals µmol/min/mg.

8. Assessing Michaelis-Menten kinetics of FAHD proteins

NOTE: Assessing Michaelis-Menten kinetics of FAHD proteins is tedious, as the specific protein activity is dependent on both the relative protein-substrate concentration and physical volume in which the reaction is taking place. Steady-state kinetics must be established in order to obtain reliable results. A tested protocol on a 96 well UV transparent plate is outlined in the following steps. Every step needs to be performed with great care, as minor errors usually spoil the experiment. It is recommended to master the assays outlined in section 7 before attempting the more complicated assay described below.

Figure 5: Exemplary results of enzyme assays.
(A) An exemplary UV absorption curve obtained for basic substrate-based FAHD protein enzyme assays (normalized into the range of 0 to 1) with standard deviation. The optical density (OD) ratio [OD(t)/OD(0)] at any given time t [OD(t)] is normalized to the initial OD [t = 0; OD(0)]. See section 7 of the protocol for more details. (B) Exemplary Michaelis-Menten kinetics of the human FAHD1 protein with standard deviation. See section 8 of the protocol for more details. Please click here to view a larger version of this figure.

1. Start a microplate reader and equilibrate for 30 min at 25 °C. Set up a program for reading 72 wells (as outlined in Figure 4B) at 255 nm. It is recommended to use 25 multiple readouts with a 5 ms time delay. Set up a cycle to measure 15x each 2 min (30 min total).
2. Perform steps 7.2 and 7.3. Then, set up 1 mL of 100 mM substrate solution in enzyme assay buffer.
3. Prepare dilutions of the substrate solution in enzyme assay buffer: 40 mM, 20 mM, 10 mM, 6 mM, 4 mM, 2 mM. The assay is performed with pairwise (“adjusted”) enzyme/substrate concentrations. For this, prepare the following dilutions of the enzyme solution in enzyme assay buffer: 0.5 µg/µL, 0.4 µg/µL, 2.5 µg/µL, 2 µg/µL, 1.5 µg/µL, 1 µg/µL.
4. Into all wells depicted in Figure 4B apply 180 µL of enzyme assay buffer. Apply 10 µL of enzyme assay buffer into all wells for the substrate (blank and sample). Apply 10 µL of the prepared protein dilution series into the wells for the enzyme (blank and sample). Apply 10 µL of enzyme assay buffer into all wells for wells for the substrate blank and the enzyme blank.
5. Right before measuring, apply 10 µL of the prepared substrate dilution series into the wells for the substrate sample and the enzyme sample.
6. Use a multichannel pipette at 50 µL settings to gently mix all wells, starting with the blanks, proceeding to the sample wells. Take care not to create any bubbles.
7. Insert the plate into a microplate reader and measure each well at 255 nm, as outlined in step 8.1. Perform the analysis in a spreadsheet. Copy the raw data from the photometer into a spreadsheet, write all settings (i.e., all documentation) into another sheet.
8. Perform individual data analysis per point in the dilution series as outlined in steps 7.11. to 7.14. Eventually, obtain all specific activities and plot against the initial substrate concentration: 2 mM, 1 mM, 0.5 mM, 0.3 mM, 0.2 mM, 0.1 mM.
9. Display all data points with individual standard deviations. Computer Michaelis-Menten kinetics via non-linear curve fitting, or via Lineweaver-Burk analysis. It may be required to re-measure individual points, and to adapt individual protein-concentration/substrate-concentration pair ratios in steps 8.5 and 8.6. The Michaelis-Menten diagram for human FAHD1 is provided in Figure 5B.

9. Crystallization of FAHD proteins

NOTE: Crystallization of FAHD proteins (human FAHD1 described previously¹⁵) may be achieved by the hanging drop vapor diffusion method in a 24 well format (Figure 6A). A step-by-step protocol on crystallization of human FAHD1 using this technique is presented below¹⁵. A more detailed description is provided in the discussion section.

Figure 6: Crystallization of FAHD proteins.
(A) Crystallization plates in standard 24 well or 96 well SBS footprint. See section 9 for more details. (B) The basic plate setup process in crystallization of FAHD proteins. This figure is redrawn with permission²³. See section 9 for more details. (C) Human FAHD1 crystals and corresponding diffraction patterns (small inserts). The closest lattice spacing is indicated in the inserts as a measure for diffraction quality of the crystals. Lower numbers indicate higher resolution and thus more informative data. See section 9 of the protocol for more details. Please click here to view a larger version of this figure.

1. Ensure that the protein is dialyzed against SEC running buffer. The FAHD1 protein should be available at high concentrations (2–5 mg/mL). At lower concentrations, the protein may not crystallize due to lack of spontaneous nucleation.
2. Prepare ≥20 mL of the reservoir solution for crystallization. Make three stock solutions, using distilled or deionized water as a solvent: 1 M Na-HEPES (minimum 25 mL, adjusted to pH 7.5), 50% (w/v) polyethylene glycol 4000 (PEG4k) (minimum 65 mL), and 1 M MgCl₂ (10 mL).
3. Setup a grid of 4 x 6 (24 total) different 15 mL tubes. Label them according to corresponding positions on the plate (e.g., row (A, B, C, D) vs. column (1–6) like “A1”, “B5”, “D6”, etc.). Pipette 1 mL of 1 M Na-HEPES into each tube.
4. Pipette 1 mL of 50% (w/v) PEG4k into row A of the tubes, 2 mL into row B, 3 mL into row C, and 4 mL into row D. Pipette 100 µL of 1 M MgCl₂ into column 1 of the tubes, 250 µL into column 2, 500 µL into column 3, 1.0 mL into column 4, 1.5 mL into column 5, and 2.0 mL into column 6.
5. Fill all tubes up to a 10 mL volume with distilled or deionized water, where the scale on the tubes is sufficiently accurate.
6. Take the human FAHD1 protein sample (~5 mg/mL) from the fridge (or from ice) and spin down at maximum speed with a table top centrifuge at 4 °C for at least 10 min. If co-crystallization with oxalate is desired, add oxalate from a stock solution so that the protein sample contains a final oxalate concentration of 2 mM. Apply 1 mM DTT and store on ice.
7. In the meantime, unpack a 24 well crystallization plate, ideally inside a temperature-controlled room at 18 °C. Distribute a thin layer of paraffin oil onto the rim on top of every well of the 24 well plate with the help of a thin glass or plastic rod. Add 800 µL of the prepared crystallization cocktails (A1 to D6) into each corresponding well of the crystallization plate.
8. Place fresh 22 mm coverslips onto a clean surface. Avoid contaminating the cover slips with dirt or dust. If necessary, remove any debris from the cover slip using compressed air or a duster spray.
9. After centrifugation is complete, avoid shaking the protein sample so that the spun-down aggregates and debris at the bottom of the tube do not float up again. In the following steps, pipette from the protein sample just below the surface of the solution in order to avoid stirring up aggregates and deposits from the bottom.
10. For each well (see Figure 6B) pipette 1 µL of protein solution onto the center of a cover slip and add 1 µL of the respective reservoir cocktail to the protein droplet, avoiding bubbles. Turn the coverslip upside down and place it onto the top of the well so that the oil seals the well with the coverslip air-tight. Repeat until the 24 well plate is completed.
11. Store the plate at 18 °C and observe the drops on a progressive schedule with a proper microscope. Human FAHD1 crystals usually appear overnight (see Figure 6C).