מיפוי RNA-RNA אינטראקציות גלובלי באמצעות Psoralen Biotinylated
Summary
כאן, אנו מפרטים את השיטה של S equen של P סורלן crosslinked, L igated, ו S נבחר H ybrids (SPLASH), אשר מאפשר מיפוי גנום רחב של interramolecular ו intermolecular RNA-RNA אינטראקציות in vivo . SPLASH ניתן ליישם את המחקר RNA אינטראקציות של אורגניזמים כולל שמרים, חיידקים ובני אדם.
Abstract
לדעת איך RNAs אינטראקציה עם עצמם ועם אחרים היא המפתח להבנת RNA הרגולציה הגן בתא. בעוד דוגמאות של אינטראקציות RNA-RNA כגון אינטראקציות microRNA-mRNA הוכחו כדי להסדיר ביטוי גנים, את מלוא היקף שבו אינטראקציות RNA להתרחש בתא עדיין לא ידוע. שיטות קודמות כדי לחקור אינטראקציות RNA התמקדו בעיקר על תת קבוצות של RNAs כי הם אינטראקציה עם חלבון מסוים או מינים RNA. כאן, אנו מפרטים שיטה בשם S equencing של P סורלן crosslinked, L igated, ו S נבחר H ybrids (SPLASH) המאפשר לכידת גנום רחב של אינטראקציות רנ"א in vivo בצורה משוחדת. SPLASH מנצל ב crosslinking vivo , קשירת הקרבה, רצף התפוקה גבוהה לזהות intramolecular ו intermolecular RNA בסיס זוגות שותפים ברחבי העולם. SPLASH ניתן ליישם אורגניזמים שונים, כולל חיידקים, שמרים ותאי אדם, כמו גםS תנאים מגוונים הסלולר כדי להקל על ההבנה של הדינמיקה של ארגון רנ"א תחת הקשרים הסלולר מגוונים. כל פרוטוקול SPLASH ניסיוני לוקח בערך 5 ימים כדי להשלים את העבודה חישובית לוקח בערך 7 ימים כדי להשלים.
Introduction
ללמוד כיצד מקרומולקולות לקפל וליצור אינטראקציה זה עם זה הוא המפתח להבנת רגולציה גנטית בתא. בעוד שמאמצים רבים התמקדו בעשור האחרון בהבנת האופן שבו דנ"א וחלבונים תורמים לרגולציה גנטית, ידוע פחות פחות על תקנה פוסט-תעתיקית של ביטוי גנים. RNA נושאת מידע הן ברצף הליניארי שלה והן במבנה המשני שלה ושלישוני 1 . היכולת שלה בסיס זוג עם עצמו ועם אחרים חשוב לתפקידה in vivo . ההתקדמות האחרונה בתפוקה גבוהה RNA מבנה משני בדיקה חיישן סיפק תובנות ערך למיקומים של אזורים בודדים כפול בודד transcriptome 2 , 3 , 4 , 5 , 6 , 7 , 8 , Howeמידע על השותפים לאינטראקציה של זוגות עדיין חסר במידה רבה. כדי לקבוע איזה רצף RNA הוא אינטראקציה עם אזור RNA אחר transcriptome, אנחנו צריכים מידע גלובלי זוג חכם.
מיפוי זוגי אינטראקציות RNA חכם באופן גלובלי, ללא דעות מוקדמות באופן מסורתי היה אתגר גדול. בעוד גישות קודמות, כגון CLASH 9 , hiCLIP 10 ו RAP 11 , משמשות לזיהוי אינטראקציות רנ"א בקנה מידה גדול, טכניקות אלה בדרך כלל מפתבות צימוד בסיס RNA עבור קבוצת משנה של RNAs או אינטראקציה עם חלבון מסוים או מינים RNA. ההתפתחויות האחרונות בחקר אינטראקציות RNA העולמי כוללים את השיטה RPL 12 , אשר אינו מייצב אינטראקציות RNA in vivo ולכן יכול רק ללכוד תת קבוצה של אינטראקציות vivo . כדי להתגבר על האתגרים הללו, אנו ואחרים פיתחנו אסטרטגיות גנומיות רחבות ובלתי מוטותP רנ"א אינטראקציה ב vivo , באמצעות גרסאות שונה של crosslinker psoralen 13 , 14 , 15 . בפרוטוקול זה, אנו מתארים את הפרטים עבור ביצוע S S השוואות של Sorsen crosslinked, L igated, ו S נבחר H ybrids (SPLASH), אשר מנצל psoralen biotinylated כדי crosslink בסיס זיווג RNAs ב vivo , ואחריו קשירת הקרבה ותפוקה גבוהה התפוקה כדי לזהות RNA בסיס זיווג שותפים גנום רחב ( איור 1 ) 15 .
בכתב יד זה, אנו מתארים את השלבים לביצוע SPLASH באמצעות תאים חסיד תרבותי, במקרה זה תאים הלה. פרוטוקול זהה ניתן להתאים בקלות תאים יונקים ההשעיה כדי שמרים תאים חיידקים. בקצרה, תאים Hella מטופלים עם psoralen biotinylated ו מוקרן ב 365 ננומטר כדי crosslink אינטראקציות RNA זוגות זוג in vivo. RNAs מחולצים מכן מן התאים, מקוטע מועשר על אזורים crosslinking באמצעות חרוזים streptavidin. אינטראקציה שברי RNA אז ligated יחד באמצעות קשירת הקרבה והפך לספריית cDNA עבור רצף עמוק. על רצף, RNAs chimeric ממופים על transcriptome / הגנום כדי לזהות את אזורי RNA אינטראקציה מותאמים זה לזה. יש לנו בהצלחה לנצל SPLASH לזהות אלפי אינטראקציות רנ"א in vivo בשמרים ותאים אנושיים שונים, כולל intramolecular ו intermolecular RNA בסיס צימוד בשיעורים שונים של RNAs, כגון snoRNAs, lncRNAs ו mRNAs, להציץ לתוך הארגון המבני דפוסי אינטראקציה של RNAs בתא.
Protocol
Representative Results
Discussion
כאן, אנו מתארים בפירוט את זרימת עבודה ניסיונית וחישובית עבור SPLASH, שיטה המאפשרת לנו לזהות אינטראקציות RNA חכם חכמים בצורה גנום רחב. אנו ניצלו בהצלחה SPLASH בתרבית חיידקים, שמרים ותרבויות האדם צופים כי האסטרטגיה יכולה להיות מיושמת באופן נרחב על אורגניזמים שונים תחת מדינות …
Disclosures
The authors have nothing to disclose.
Acknowledgements
אנו מודים לחברי המעבדה וואן ומעבדת Nagarajan לדיונים אינפורמטיביים. N.Nagarajan נתמך על ידי מימון מ * כוכב. Y.Wan נתמך על ידי מימון מ- A * סטאר וחברה במדע- Branco Weiss Fellowship.
Materials
| 1 Kb Plus DNA Ladder | Life Technologies Holdings Pte Ltd | 10787026 | DNA ladder |
| 10 bp DNA ladder | Life Technologies Holdings Pte Ltd | 10821-015 | DNA ladder |
| 20 % SDS solution | First BASE | BUF-2052-1L | |
| 20x SSC | First BASE | BUF-3050-20X1L | |
| 3.0 M Sodium Acetate Solution | First BASE | BUF-1151-1L-pH5.2 | Required for nucleic acid precipitation |
| 40% Acrylamide/Bis Solution, 19:1 | Bio-Rad | 1610145 | TBE Urea gel component |
| Ambion Buffer Kit | Life Technologies Holdings Pte Ltd | AM9010 | |
| Ammonium Persulfate, Molecular Grade | Promega | V3131 | TBE Urea gel component |
| Bromophenol Blue | Sigma-Aldrich | B0126-25G | |
| Chloroform | Merck | 1.02445.1000 | RNA extraction |
| Single strand DNA ligase | Epicentre | CL9025K | CircLigase II ssDNA Ligase |
| Centrifuge tube filters | Sigma-Aldrich | CLS8160-96EA | Costar Spin-X centrifuge tube filters |
| D5628-1G DIGITONIN CRYSTALLINE | Sigma-Aldrich | D5628-1G | For cell treatment |
| Dark Reader Transilluminator | Clare Chemical Research | Dark Reader DR89X Transilluminator | Blue light transilluminator |
| DNA Gel Loading Dye (6X) | Life Technologies Holdings Pte Ltd | R0611 | Required for agarose gel electroporation |
| Dulbecco's Modified Eagle Medium | Pan BioTech | P04-03500 | For Hela cell culture |
| Streptavidin magnetic beads | Life Technologies Holdings Pte Ltd | 65002 | Dynabeads MyOne Streptavidin C1 |
| Magnetic stand for 15ml tubes | Life Technologies Holdings Pte Ltd | 12301D | DynaMag-15 |
| Magnetic stand for 15ml tubes | Life Technologies Holdings Pte Ltd | 12321D | DynaMag-2 |
| ThermoMixer | Eppendorf | 5382 000.015 | Eppendorf ThermoMixer C |
| Biotinylated psoralen | Life Technologies Holdings Pte Ltd | 29986 | EZ-Link Psoralen-PEG3-Biotin |
| F8T5/BL | Hitachi | F8T5/BL | 365 nm UV bulb |
| Fetal Bovine Serum | Life Technologies Holdings Pte Ltd | 10270106 | Components of Hela medium |
| Formamide | Promega | H5052 | Component in hybridization buffer |
| G8T5 | Sankyo-Denki | G8T5 | 254 nm UV bulb |
| Glycogen | Life Technologies Holdings Pte Ltd | 10814010 | Required for nucleic acid precipitation |
| Nanodrop | Life Technologies Holdings Pte Ltd | Nanodrop 2000 | Spectrophotometer for nucleic acidquantification |
| Nuclease free water | First BASE | BUF-1180-500ml | |
| Penicillin Streptomycin | Life Technologies Holdings Pte Ltd | 15140122 | Components of Hela medium |
| High-Fidelity DNA polymerase (2x) | Life Technologies Holdings Pte Ltd | F531L | Phusion High-Fidelity PCR Master Mix with HF Buffer (2x) |
| Primers Set 1 | New England Biolabs | E7335L | PCR primers |
| DNA Gel Extraction Kit | QIAgen | 28106 | QIAquick Gel Extraction Kit |
| Fluorometric Quantification kit | Life Technologies Holdings Pte Ltd | Q32854 | Qubit dsDNA HS Assay Kit |
| RNA clean up kit | Qiagen | 74106 | RNeasy Mini Kit Silica-membrane column |
| Rnase Inhibitor | Life Technologies Holdings Pte Ltd | AM2696 | SUPERase In |
| Reverse transcriptase | Life Technologies Holdings Pte Ltd | 18080400 | SuperScript III First-Strand Synthesis SuperMix |
| Nucleic Acid Gel Stain | Life Technologies Holdings Pte Ltd | S11494 | SYBR GOLD NUCLEIC ACID 500 UL |
| T4 Polynucleotide Kinase | New England Biolabs | M0201L | End repair enzyme |
| T4 RNA Ligase 1 | New England Biolabs | M0204L | Enzyme for proximity ligation |
| T4 RNA Ligase 2, truncated KQ | New England Biolabs | M0373L | Enzyme for adaptor ligation |
| Temed | Bio-Rad | 1610801 | TBE Urea gel component |
| Guanidinium thiocyanate-phenol-chloroform | Life Technologies Holdings Pte Ltd | 15596018 | TRIzol® Reagent for RNA extraction |
| Urea | First BASE | BIO-2070-5kg | |
| UV crosslinker | Stratagene | 400072 | UV Stratalinker 1800 |
| UV Transilluminator | UVP | 95-0417-01 | For visualizing of bands |
| Xylene Cyanol FF | Sigma-Aldrich | X4126-10G | |
| DNA cleanup it | Zymo Research | D4004 | Zymo DNA concentrator-5 |
| List of software required | |||
| FastQC software | 0.11.4 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | |
| SeqPrep software | 1.0.7 | https://github.com/jstjohn/SeqPrep | |
| BWA software | 0.7.12 | http://bio-bwa.sourceforge.net/ | |
| SAMTOOLS software | 1.2.1 | http://www.htslib.org/ | |
| PULLSEQ software | 1.0.2 | https://github.com/bcthomas/pullseq | |
| STAR software | 2.5.0c | https://github.com/alexdobin/STAR | |
| rem_dups.py PYTHON script | PYTHON 2.7.11 | https://github.com/CSB5/splash/tree/master/src | |
| find_chimeras.py PYTHON script | PYTHON 2.7.11 | https://github.com/CSB5/splash/tree/master/src | |
| pickJunctionReads.awk AWK script | AWK GNU 4.1.2 | https://github.com/CSB5/splash/tree/master/src | |
| Buffer composition | |||
| Elution buffer: | |||
| 0.3 M sodium acetate | |||
| Lysis Buffer: | |||
| 50 mM Tris-Cl pH 7.0 | |||
| 10 mM EDTA | |||
| 1% SDS | |||
| Always add Superase-in fresh before use except when washing beads | |||
| Proteinase K Buffer | |||
| 100 mM NaCl | |||
| 10 mM TrisCl pH 7.0 | |||
| 1 mM EDTA | |||
| 0.5% SDS | |||
| Hybridization Buffer | |||
| 750 mM NaCl | |||
| 1% SDS | |||
| 50 mM Tris-Cl pH 7.0 | |||
| 1 mM EDTA | |||
| 15% formamide (store in the dark at 4 °C) | |||
| Always add Superase-in fresh before use | |||
| 2x SSC Wash Buffer | |||
| 2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock) | |||
| 0.5% SDS | |||
| 2X RNA fragmentation buffer | |||
| 18mM MgCl2 | |||
| 450mM KCl | |||
| 300mM Tris-CL pH 8.3 | |||
| 2x RNA loading Dye: | |||
| 95% Formamide | |||
| 0.02% SDS | |||
| 0.02% bromophenol blue | |||
| 0.01% Xylene Cyanol | |||
| 1mM EDTA | |||
| 3' RNA adapter sequence | 5rAppCTGTAGGCACCATCAAT/3ddC | ||
| RT primer sequence | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG |
References
- Wan, Y., Kertesz, M., Spitale, R. C., Segal, E., Chang, H. Y. Understanding the transcriptome through RNA structure. Nat.Rev.Genet. 12 (9), 641-655 (2011).
- Kertesz, M., et al. Genome-wide measurement of RNA secondary structure in yeast. Nature. 467 (7311), 103-107 (2010).
- Wan, Y., et al. Genome-wide Measurement of RNA Folding Energies. Mol.Cell. 48 (2), 169-181 (2012).
- Wan, Y., Qu, K., Ouyang, Z., Chang, H. Y. Genome-wide mapping of RNA structure using nuclease digestion and high-throughput sequencing. Nat.Protoc. 8 (5), 849-869 (2013).
- Wan, Y., et al. Landscape and variation of RNA secondary structure across the human transcriptome. Nature. 505 (7485), 706-709 (2014).
- Spitale, R. C., et al. Structural imprints in vivo decode RNA regulatory mechanisms. Nature. 519 (7544), 486-490 (2015).
- Ding, Y., et al. In vivo genome-wide profiling of RNA secondary structure reveals novel regulatory features. Nature. 505 (7485), 696-700 (2014).
- Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., Weissman, J. S. Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature. 505 (7485), 701-705 (2014).
- Kudla, G., Granneman, S., Hahn, D., Beggs, J. D., Tollervey, D. Cross-linking, ligation, and sequencing of hybrids reveals RNA-RNA interactions in yeast. Proc.Natl.Acad.Sci.U.S.A. 108 (24), 10010-10015 (2011).
- Sugimoto, Y., et al. hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1. Nature. 519 (7544), 491-494 (2015).
- Engreitz, J. M., et al. RNA-RNA interactions enable specific targeting of noncoding RNAs to nascent Pre-mRNAs and chromatin sites. Cell. 159 (1), 188-199 (2014).
- Ramani, V., Qiu, R., Shendure, J. High-throughput determination of RNA structure by proximity ligation. Nat.Biotechnol. , (2015).
- Lu, Z., et al. RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure. Cell. 165 (5), 1267-1279 (2016).
- Sharma, E., Sterne-Weiler, T., O’Hanlon, D., Blencowe, B. J. Global Mapping of Human RNA-RNA Interactions. Mol.Cell. 62 (4), 618-626 (2016).
- Aw, J. G., et al. In Vivo Mapping of Eukaryotic RNA Interactomes Reveals Principles of Higher-Order Organization and Regulation. Mol.Cell. 62 (4), 603-617 (2016).
