בידוד, הפצת וביטוי חלבונים פריון במהלך עצביים התמיינות של תאי גזע אנושי זולה שיניים
Summary
כאן אנו מציגים עבור בידוד תאי גזע זולה שיניים האנושי והתפשטות פרוטוקול על מנת להעריך את הביטוי חלבון פריאון בתהליך בידול עצביים.
Abstract
Bioethical נושאים הקשורים המניפולציה של תאי גזע עובריים יש הפריע ההתקדמות בתחום המחקר הרפואי. מסיבה זו, חשוב מאוד לקבל בתאי גזע בוגרים רקמות שונות כמו שומן, חבל הטבור, מח עצם ודם. בין מקורות אפשריים, עיסת שיניים הוא מעניין במיוחד כי זה קל להשיג בגין שיקולים bioethical. אכן, שיניים זולה תאי גזע אנושי (hDPSCs) הם סוג של תאי גזע בוגרים מסוגלים להבדיל תאים עצביים כמו, ניתן להשיג את השן הטוחנת השלישית של מטופלים בריאים (גילאי 13-19). בפרט, הציפה שיניים היה להסיר עם החופר, וחותכים לפרוסות, שטופלו collagenase הרביעי ותרבותית בבקבוקון. כדי לעודד את הבידול עצביים, hDPSCs היו מגורה עם EGF/bFGF 2 שבועות. בעבר, הראו כי במהלך תהליך התמיינות התוכן של פריון הסלולר חלבון (PrPC) hDPSCs מוגבר. הניתוח cytofluorimetric הראה ביטוי מוקדם PrPC זה גדל לאחר תהליך התמיינות עצביים. אבלציה של PrPC על ידי siRNA PrP מנעו בידול עצביים שנגזרות EGF/bFGF. בנייר זה, אנו ממחישים כי כפי שאנחנו משופרת של בידוד, ההפרדה ושיטות במבחנה הטיפוח של hDPSCs עם מספר הליכים קל, יעיל יותר תא שיבוטים היו הרחבת שהושג, בקנה מידה גדול גזע mesenchymal (MSCs) נצפתה. אנו גם מראים hDPSCs, שהושג עם שיטות מפורטות בפרוטוקול, מה שלומך. מדגם ניסיוני מצוינת ללמוד את תהליך התמיינות עצביים של MSCs ותהליכים תאית ומולקולרית עוקבות.
Introduction
גזע mesenchymal היה מבודד מספר רקמות, כולל מח עצם, דם טבורי, אנושית זולה שיניים, רקמת שומן, דם1,2,3,4,5 , 6. כפי שדווח על ידי מספר סופרים, hDPSCs להראות הדבקות מפלסטיק, מורפולוגיה פיברובלסט דמוי טיפוסי. אלה מייצגים אוכלוסיה הטרוגנית מאוד עם שיבוטים נפרדות וההבדלים המקדימות, המבדילים קיבולת7,8. hDPSCs אקספרס סמנים ספציפי עבור גזע mesenchymal (קרי CD44, CD90, CD73, CD105, כלי קשת-1), הם שליליים עבור כמה סמנים hematopoietic (כגון CD14 ו- CD19), מסוגלים במבחנה בידול multilineage9, 10,11.
מספר סופרים הראו כי תאים אלה הם מסוגלים להבדיל לתוך נוירון כמו תאים באמצעות פרוטוקולים שונים, כולל התוספת של גורם הגדילה העצבי, bFGF, EGF בשילוב עם ספציפי מדיה ותוספי7,12. בנוסף, חלבונים רבים מעורבים בתהליך בידול עצביים ולהראות, בקרב אלו, בכמה עיתונים תפקידים רלוונטיים ושניהם ביטוי משמעותי של חלבון פריאון הסלולר (PrPC), תאי גזע עובריים והוא בוגר13, 14. PrPC מייצג מולקולה pleiotropic המסוגלים לבצע פונקציות שונות בתוך תאים כמו מטבוליזם נחושת, אפופטוזיס, ואת התנגדות חימצוני מתח15,16,17 , 18 , 19 , 20 , 21 , 22.
שלנו הקודם נייר23, חקרנו את התפקיד של PrPC בתהליך בידול עצביים hDPSCs. למעשה, hDPSCs אקספרס precociously PrPC וזה, אחרי בידול עצביים, היה ניתן לצפות להגדלה נוספת. מחברים אחרים שיערו תפקיד אפשרי של PrPC בתהליכים עצביים התמיינות של תאי גזע. אכן, PrPC מניע את הבידול של תאי גזע עובריים לתוך הנוירונים oligodendrocytes להפוך, האסטרוציטים24. מטרתו של מחקר זה היה כדי להדגיש את המתודולוגיה להשגת בתאי גזע של שיניים זולה, תהליך הבידול שלו ואת התפקיד של PrPC במהלך התמיינות עצביים.
Protocol
Representative Results
Discussion
בעבודה זאת, התמקדנו מתודולוגיה בידוד ובידול עצביים של hDPSCs; יתר על כן, הערכנו את התפקיד של PrPC בתהליך זה. ישנן מספר שיטות כדי לבודד, להבדיל hDPSCs תאים דמויי נוירון, שלבים קריטיים בתהליך. hDPSCs מסוגלים להבדיל ב מספר שושלות כגון chondroblasts, adipocytes, תאי העצם נוירונים. בעיתון שלנו, חקרנו את המנגנונים …
Disclosures
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכה על ידי “דל’אנג’לו Varrone” ומרכז אוניברסיטה שעונה “סבינה Universitas” כדי וינצ’נצו מאטיי.
איור 5 (A, B) התפרסם בכתב מאת רשות של המפרסם טיילור & פרנסיס בע מ מ: תפקיד של פריון חלבון-EGFR מתחם multimolecular במהלך התמיינות עצביים של שיניים זולה-derived תאי גזע אנושי. Martellucci, ס., Manganelli ו’, ג סנטקרוצ’ה, יצור פ, ל’ פיקולי, Sorice מ, מאטיי ו’ פריון. 2018 Mar 4. טיילור & פרנסיס בע מ
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
References
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
