Isolamento, propagação e expressão de proteína príon durante a diferenciação Neuronal de células-tronco humanas polpa Dental
Summary
Aqui nós apresentamos um protocolo para isolamento de células-tronco polpa Dental humana e propagação a fim de avaliar a expressão da proteína príon durante o processo de diferenciação neuronal.
Abstract
Problemas bioéticos relacionados à manipulação de células-tronco embrionárias tem dificultado avanços no campo da pesquisa médica. Por esta razão, é muito importante obter células-tronco adultas de diferentes tecidos como adiposo, cordão umbilical, medula óssea e sangue. Entre as fontes possíveis, a polpa dental é particularmente interessante, porque é fácil de obter em relação às considerações bioéticas. Com efeito, Dental Pulp células estaminais humanas (hDPSCs) são um tipo de células-tronco adultas possam diferenciar em células neuronais e pode ser obtido o terceiro molar de pacientes saudáveis (idade 13-19). Em particular, a polpa dental foi removida com uma escavadeira, corte em fatias pequenas, tratada com colagenase IV e cultivada em um balão. Para induzir a diferenciação neuronal, hDPSCs foram estimulados com EGF/bFGF por 2 semanas. Anteriormente, temos demonstrado que durante o processo de diferenciação do conteúdo de celular prion proteínas (PrPC) no hDPSCs aumentaram. A análise cytofluorimetric mostrou uma expressão inicial de PrPC que aumentou após o processo de diferenciação neuronal. Ablação do PrPC por siRNA PrP impediu a diferenciação neuronal induzida pelo bFGF/EGF. Neste trabalho, ilustramos que como temos realçado o isolamento, separação e em vitro métodos de cultivo de hDPSCs com vários procedimentos fácil, mais eficientes clones de células foram obtido e em grande escala de expansão das células tronco mesenquimais (MSCs) observou-se. Também mostramos como os hDPSCs, obtidos com métodos detalhados no protocolo, são um excelente modelo experimental para estudar o processo de diferenciação neuronal de MSCs e subsequentes processos celulares e moleculares.
Introduction
Células-tronco mesenquimais foram isoladas de vários tecidos, incluindo a medula óssea, sangue de cordão umbilical, polpa dentária humana, tecido adiposo e sangue1,2,3,4,5 , 6. como relatado por vários autores, hDPSCs mostrar aderência de plástico, uma morfologia típica de fibroblasto tipo. Estes representam uma população altamente heterogênea com clones distintos e diferenças na capacidade proliferativa e diferenciação7,8. hDPSCs express marcadores específicos para células-tronco mesenquimais (ou seja, CD44, CD90, CD73, CD105, STRO-1), são negativos para alguns marcadores hematopoiéticas (tais como o CD14 e CD19) e são capazes de diferenciação in vitro de multilineage9, 10,11.
Vários autores têm mostrado que essas células são capazes de se diferenciar em células neurônio usando protocolos diferentes, que incluem a adição de NGF, bFGF, EGF em combinação com o específico mídia e suplementos7,12. Além disso, muitas proteínas estão envolvidas durante o processo de diferenciação neuronal e, entre estes, vários trabalhos mostram um papel relevante e significativa expressão da proteína príon celular PrP (C), ambos em células-tronco adultas e embrionárias13, 14. PrPC representa uma molécula pleiotrópicos capaz de executar diferentes funções no interior das células como metabolismo de cobre, apoptose, e resistência à oxidativo estresse15,16,17 , 18 , 19 , 20 , 21 , 22.
Nosso papel anterior23, investigamos o papel do PrPC no processo de diferenciação neuronal hDPSCs. Na verdade, hDPSCs express precocemente PrPC e, após a diferenciação neuronal, foi possível observar um aumento adicional. Outros autores a hipótese de um possível papel de PrPC em processos de diferenciação neuronal de células-tronco. Com efeito, PrPC dirige a diferenciação de células-tronco embrionárias humanas em neurônios, oligodendrócitos e astrócitos24. O objetivo deste estudo foi enfatizar a metodologia para a obtenção de células-tronco da polpa dentária, seu processo de diferenciação e o papel do PrPC durante a diferenciação neuronal.
Protocol
Representative Results
Discussion
Neste trabalho, concentrámo-na metodologia para isolamento e diferenciação neuronal de hDPSCs; Além disso, avaliamos o papel do PrPC neste processo. Existem vários métodos para isolar e diferenciar hDPSCs em células neurônio e passos críticos durante o processo. hDPSCs são capazes de se diferenciar em várias linhagens como condroblastos, osteoblastos, adipócitos e neurônios. Nosso papel, investigamos os mecanismos de diferenciação neuronal e a presença de PrPC. Como discutido acima, …
Disclosures
The authors have nothing to disclose.
Acknowledgements
Este trabalho foi apoiado pela “Fondazione Varrone” e Universidade de Rieti Hub “Sabina Universitas” de Vincenzo Mattei.
Figura 5 (A, B) reimpresso com permissão da editora Taylor & Francis Ltd de: complexo multimolecular de papel de príon proteína EGFR durante a diferenciação neuronal de dentais derivado de celulose células estaminais humanas. Martellucci, S., V. de Manganelli, Santacroce C. F. Santilli, L. Piccoli, M. Sorice, V. Mattei prião. 4 de março de 2018. Taylor & Francis Ltd.
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
References
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
