Isolement, Propagation et Expression de la protéine Prion au cours de la différenciation neuronale de cellules souches humaines pulpe dentaire
Summary
Nous présentons ici un protocole pour humain isolement des cellules souches pulpe dentaire et propagation afin d’évaluer l’expression de la protéine prion au cours du processus de différenciation neuronale.
Abstract
Les enjeux éthiques associés à la manipulation des cellules souches embryonnaires ont entravé les progrès dans le domaine de la recherche médicale. Pour cette raison, il est très important d’obtenir des cellules souches adultes de différents tissus tels que les tissus adipeux, cordon ombilical, la moelle osseuse et le sang. Parmi les sources possibles, la pulpe dentaire est particulièrement intéressant parce qu’il est facile d’obtenir en ce qui concerne les considérations bioéthiques. En effet, Dental Pulp des cellules souches humaines (hDPSCs) sont un type de cellules souches adultes capables de se différencier en cellules neuronales semblables et peuvent provenir de la troisième molaire des patients en bonne santé (âgés de 13 à 19). En particulier, la pulpe dentaire a été enlevée avec une excavatrice, coupée en petites tranches, traitée par collagénase IV et cultivée dans un ballon jaugé. Pour induire la différenciation neuronale, hDPSCs ont été stimulées avec EGF/bFGF pendant 2 semaines. Auparavant, nous avons démontré qu’au cours du processus de différenciation de prion cellulaire protéine (PrPC) en hDPSCs augmenté. L’analyse cytofluorométrique ont montré une expression précoce de la PrPC qui a augmenté après le processus de différenciation neuronale. Ablation de la PrPC de siARN PrP a empêché la différenciation neuronale induite par l’EGF/bFGF. Dans cet article, Nous illustrons que que nous avons amélioré l’isolement, de séparation et de méthodes de culture in vitro de hDPSCs avec plusieurs opérations simples, les clones de cellules plus efficaces étaient expansion obtenue et à grande échelle des cellules souches mésenchymateuses (CSM) a été observée. Nous montrons aussi comment les hDPSCs, obtenues avec les méthodes décrites dans le protocole, sont un excellent modèle expérimental pour étudier le processus de différenciation neuronale de MSCs et procédés cellulaires et moléculaires.
Introduction
Cellules souches mésenchymateuses ont été isolées de divers tissus, y compris la moelle osseuse, sang de cordon ombilical, pulpe dentaire humain, le tissu adipeux et sang1,2,3,4,5 , 6. comme indiqué par plusieurs auteurs, hDPSCs montrent une adhésion en plastique, une morphologie typique des fibroblastes. Il s’agit d’une population très hétérogène avec des clones distincts et les différences dans la capacité de prolifération et de différenciation7,8. hDPSCs expriment des marqueurs spécifiques des cellules souches mésenchymateuses (CD44, CD90, CD73, CD105, STRO-1), ils sont négatifs pour certains marqueurs hématopoïétiques (comme CD14 et CD19) et sont capables de différenciation multilignée in vitro9, 10,11.
Plusieurs auteurs ont montré que ces cellules sont capables de se différencier en cellules de neurone comme utilisant des protocoles différents, qui comprennent l’ajout de NGF, bFGF, EGF en combinaison avec le spécifique médias et suppléments7,12. En outre, beaucoup de protéines est impliquées au cours du processus de différenciation neuronale et, parmi ceux-ci, plusieurs journaux montre un rôle pertinent et une expression significative de la protéine prion cellulaire (PrPC), aussi bien dans les cellules souches embryonnaires et adultes13, 14. PrPC représente une molécule pléiotrope capable de remplir des fonctions différentes à l’intérieur de cellules dans le métabolisme du cuivre, l’apoptose, et résistance à l’oxydation stress15,16,17 , 18 , 19 , 20 , 21 , 22.
Dans notre précédente du livre23, nous avons examiné le rôle de la PrPC dans le processus de différenciation neuronale hDPSCs. En fait, hDPSCs exprimer précocement PrPC et, après la différenciation neuronale, il était possible d’observer une augmentation supplémentaire. D’autres auteurs l’hypothèse d’un rôle possible de la PrPC dans les processus de différenciation neuronale de cellules souches. En effet, PrPC entraîne la différenciation des cellules souches embryonnaires humaines dans les neurones, les astrocytes et oligodendrocytes24. Le but de cette étude était de mettre l’accent sur la méthodologie pour l’obtention de cellules souches de la pulpe dentaire, ses processus de différenciation et le rôle de la PrPC au cours de la différenciation neuronale.
Protocol
Representative Results
Discussion
Dans ce travail, nous nous sommes concentrés sur les méthodes d’isolement et de la différenciation neuronale de hDPSCs ; en outre, nous avons évalué le rôle de la PrPC dans ce processus. Il y a plusieurs méthodes pour isoler et différencier hDPSCs en cellules semblables à des neurones et des étapes critiques au cours du processus. hDPSCs sont capables de se différencier en plusieurs lignées comme chondroblastes, adipocytes, ostéoblastes et neurones. Dans notre document, nous avons étudié les …
Disclosures
The authors have nothing to disclose.
Acknowledgements
Ce travail a été soutenu par la « Fondazione Varrone » et Rieti Université Hub « Sabina Universitas » de Vincenzo Mattei.
La figure 5 (A, B) reproduit avec la permission de l’éditeur Taylor & Francis Ltd du : complexe multimoléculaire de rôle de Prion protein-EGFR durant la différenciation neuronale des humains cellules souches issues de pulpe dentaires. Mekki, S., Manganelli V., C. Santacroce, Santilli F., L. Piccoli, Sorice M. Mattei V. Prion. Le 4 mars 2018. Taylor & Francis Ltd.
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
References
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
