JoVE Journal > Immunology and Infection
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Deutsch

Automatically Generated
Please note that all translations are automatically generated. Click here for the English version.
Immunology and Infection

Eine einfache Protokoll ortspezifisch generieren acetyliert Proteine in Escherichia Coli

Published: December 09, 2017
doi:
10.3791/57061
, , , ,
1Department of Chemistry and Biochemistry,University of Arkansas, 2Cell and Molecular Biology Program,University of Arkansas, 3Department of Biological Sciences,University of Arkansas, 4Fayetteville High School

Summary

Erweiterung des genetischen Codes dient als ein mächtiges Werkzeug für eine Vielzahl von biologischen Prozessen, einschließlich Protein Acetylierung zu studieren. Hier zeigen wir, dass eine einfache Protokoll nutzen diese Technik zur Erzeugung von homogen Proteine an bestimmten Standorten in Escherichia coli Zellen acetyliert.

Abstract

Post-translationalen Modifikationen, die an bestimmten Positionen von Proteinen entstehen nachweislich in einer Vielzahl von zellulären Prozessen eine wichtige Rolle spielen. Unter ihnen ist eines der am weitesten verbreitete reversible Lysin Acetylierung in allen Bereichen des Lebens. Obwohl zahlreiche Massenspektrometrie-basierte Acetylome Studien durchgeführt worden, weitere wurde Charakterisierung dieser vermeintlichen Acetylierung Ziele beschränkt. Ein möglicher Grund ist, dass es schwierig ist, rein Schimmelpilzschäden Proteine an den gewünschten Positionen durch die meisten klassischen biochemischen Ansätzen zu generieren. Um diese Herausforderung zu meistern, hat die genetischen Code Ausbau Technik angewendet, um das Paar ein veränderter Pyrrolysyl-tRNA Synthestase Variante und seine Verwandten tRNA von Methanosarcinaceae Arten verwenden, um die cotranslational Aufnahme leiten der Acetyllysine auf der Website des Proteins des Interesses. Nach der ersten Anwendung in der Studie von Histon Acetylierung hat dieser Ansatz Acetylierung Studien auf einer Vielzahl von Proteinen erleichtert. In dieser Arbeit haben wir eine einfache Protokoll zur ortspezifisch Schimmelpilzschäden Proteine zu produzieren, mit dem Modell Bakterium Escherichia coli als Gastgeber gezeigt. Malat-Dehydrogenase diente als ein Demo-Beispiel in diesem Werk.

Introduction

Post-translationalen Modifikationen (PTMs) von Proteinen auftreten, nachdem Sie den Übersetzungsprozess und entstehen durch kovalente Zugabe von funktionellen Gruppen zu Aminosäurereste, spielen eine wichtige Rolle in fast allen biologischen Prozessen, einschließlich gen Transkription, Stress-Reaktion, Zelldifferenzierung und Stoffwechsel1,2,3. Bis heute wurden etwa 400 unverwechselbaren wurden PTMs identifizierten4. Die Komplexität des Genoms und die Proteome wird zu einem großen Teil durch Protein PTMs verstärkt, wie sie Proteinaktivität und Lokalisierung zu regulieren, und die Interaktion mit anderen Molekülen wie Proteinen, Nukleinsäuren und Lipiden Cofaktoren5 beeinflussen.

Protein-Acetylierung wurde an der Spitze der PTMs Studien in den letzten zwei Jahrzehnten6,7,8,9,10,11,12. Lysin Acetylierung wurde zuerst in Histone vor mehr als 50 Jahren entdeckt,13,14, wurde auch geprüft, und ist bekannt in mehr als 80 Transkriptionsfaktoren, Regulatoren und verschiedene Proteine15vorhanden sein, 16,17. Studien über Protein Acetylierung haben nicht nur uns ein tieferes Verständnis für seine Regulationsmechanismen zur Verfügung gestellt, aber auch Behandlungen für eine Reihe von Krankheiten, die durch dysfunktionalen Acetylierung18,19, geführt 20 , 21 , 22 , 23. glaubte man, dass Lysin Acetylierung nur in Eukaryoten geschieht, aber neuere Studien gezeigt haben, dass Protein Acetylierung spielt auch Schlüsselrollen in der bakteriellen Physiologie einschließlich Chemotaxis, Säurebeständigkeit, Aktivierung und Stabilisierung der im Zusammenhang mit Proteinen24,25,26,27,28,29, Pathogenitätsinseln und andere Virulenz.

Eine häufig verwendete Methode, biochemisch Lysin Acetylierung zu charakterisieren ist Site-verwiesene Mutagenese verwendet. Glutamin dient als eine Imitation des Acetyllysine wegen der ähnlichen Größe und Polarität. Arginin wird als ein nicht acetyliert Lysin Mimic genutzt, da es seine positiven Ladung unter physiologischen Bedingungen bewahrt aber kann nicht acetyliert. Jedoch beide Mimik sind nicht real Isosteres und nicht immer die erwarteten Ergebnisse30Ausbeute. Der strengste Ansatz soll homogen Schimmelpilzschäden Proteine an bestimmten Lysin Rückstände zu generieren, das ist schwierig oder unmöglich für die meisten klassischen Methoden aufgrund der niedrigen Stöchiometrie von Lysin Acetylierung in Natur7,11. Diese Herausforderung hat durch den genetischen Code Expansionsstrategie, die ein veränderter Pyrrolysyl-tRNA Synthestase beschäftigt entwirrt worden Variante von Methanosarcinaceae Arten tRNA aufladenPyl mit Acetyllysine, nutzt den Host Translationale Maschinen zu unterdrücken, die UAG Codon in der mRNA zu stoppen und leitet die Einbeziehung von Acetyllysine in der gestalteten Position der Ziel-Protein-31. Vor kurzem haben wir dieses System mit einer verbesserten EF-Tu-Bindung tRNA-32 und eine verbesserte Acetyllysyl-tRNA Synthestase33optimiert. Darüber hinaus haben wir dieses System verbesserte Einbindung in Acetylierung Studien Malate Dehydrogenase34 und Tyrosyl-tRNA Synthestase35angewandt. Hier zeigen wir das Protokoll zur Erzeugung von rein Schimmelpilzschäden Proteine aus der molekularen Klonen biochemische Identifizierung mithilfe von Malat-Dehydrogenase (MDH), die wir als demonstratives Beispiel ausgiebig studiert haben.

Protocol

1. Site-verwiesene Mutagenese des Zielgens Hinweis: MDH drückt sich unter T7 Promotor im pCDF-1 Vektor mit den CloDF13 Ursprung und Ausfertigung von 20 bis 4034eine eigene Nummer. Einführung der Bernstein Stopcodon an der Position 140 im gen durch Primer (Grundierung weiterleiten: GGTGTTTATGACTAGAACAAACTGTTCGGCG und reverse Primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), entsprechend den Anweisungen des Site-verwiesene Mutagenese …

Representative Results

Die Ausbeute an Schimmelpilzschäden MDH Protein war 15 mg pro 1 L Kultur, während das Wildtyp MDH 31 mg pro 1 L Kultur war. Gereinigten Proteine wurden von SDS-PAGE analysiert, wie in Abbildung 1dargestellt. Der Wildtyp MDH diente als eine Positivkontrolle34. Das Protein gereinigt von Zellen beherbergen das Acetyllysine (AcK)-Aufnahme-System und das mutierte Mdh -gen, aber ohne AcK im Wachstumsmedium, diente als Negativkontr…

Discussion

Die genetische Einbeziehung der noncanonical Aminosäuren (NcAAs) basiert auf der Unterdrückung der einen zugewiesenen Codon, meist die Bernstein Stopp-Codon UAG36,37,38,39, von der ncAA aufgeladen tRNA enthält die entsprechenden Anticodon. Wie bekannt ist, ist das UAG-Codon von den Release Faktor-1 (RF1) in Bakterien erkannt, und es kann auch unterdrückt werden, indem in der Nähe von cogna…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Diese Arbeit wurde durch das NIH (AI119813), die Inbetriebnahme von der University of Arkansas und die Auszeichnung von Arkansas Biosciences Institute unterstützt.

Materials

Bradford protein assay Bio-Rad 5000006 Protein concentration
4x Laemmli Sample Buffer Bio-Rad 1610747 SDS sample buffer
Coomassie G-250 Stain Bio-Rad 1610786 SDS-PAGE gel staining
4-20% SDS-PAGE ready gel Bio-Rad 4561093 Protein determination
Ac-K-100 (HRP Conjugate) Cell Signaling 6952 Antibody
IPTG CHEM-IMPEX 194 Expression inducer
Nε-Acetyl-L-lysine CHEM-IMPEX 5364 Noncanonical amino acid
PD-10 desalting column GE Healthcare 17085101 Desalting
Q5 Site-Directed Mutagenesis Kit NEB E0554 Introducing the stop codon
BL21 (DE3) cells NEB C2527 Expressing strain
QIAprep Spin Miniprep Kit QIAGEN 27106 Extracting plasmids
Ni-NTA resin QIAGEN 30210 Affinity purification resin
nicotinamide Sigma-Aldrich N3376 Deacetylase inhibitor
β-Mercaptoethanol Sigma-Aldrich M6250 Reducing agent
BugBuster Protein Extraction Reagent Sigma-Aldrich 70584 Breaking cells
Benzonase nuclease Sigma-Aldrich E1014 DNase
ECL Western Blotting Substrate ThermoFisher 32106 Chemiluminescence
Premixed LB Broth VWR 97064 Cell growth medium
Bovine serum albumin VWR 97061-416 western blots blocking
DOWNLOAD MATERIALS LIST

References

  1. Krishna, R. G., Wold, F. Post-translational modification of proteins. Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).
  2. Lothrop, A. P., Torres, M. P., Fuchs, S. M. Deciphering post-translational modification codes. FEBS Lett. 587 (8), 1247-1257 (2013).
  3. Walsh, C. T. . Posttranslational modification of proteins : expanding nature’s inventory. , (2006).
  4. Khoury, G. A., Baliban, R. C., Floudas, C. A. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep. 1, (2011).
  5. Grotenbreg, G., Ploegh, H. Chemical biology: dressed-up proteins. Nature. 446 (7139), 993-995 (2007).
  6. Arif, M., Selvi, B. R., Kundu, T. K. Lysine acetylation: the tale of a modification from transcription regulation to metabolism. Chembiochem. 11 (11), 1501-1504 (2010).
  7. Cohen, T., Yao, T. P. AcK-knowledge reversible acetylation. Science’s STKE : signal transduction knowledge environment. (245), pe42 (2004).
  8. Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. The world of protein acetylation. Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).
  9. Escalante-Semerena, J. C. Nε-acetylation control conserved in all three life domains. Microbe. 5, 340-344 (2010).
  10. Kouzarides, T. Acetylation: a regulatory modification to rival phosphorylation?. The EMBO journal. 19 (6), 1176-1179 (2000).
  11. Soppa, J. Protein acetylation in archaea, bacteria, and eukaryotes. Archaea. , (2010).
  12. Verdin, E., Ott, M. 50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond. Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).
  13. Allfrey, V. G., Faulkner, R., Mirsky, A. E. Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. P Natl Acad Sci USA. 51, 786-794 (1964).
  14. Phillips, D. M. The presence of acetyl groups of histones. Biochem j. 87, 258-263 (1963).
  15. Sterner, D. E., Berger, S. L. Acetylation of histones and transcription-related factors. Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).
  16. Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. Acetylation and deacetylation of non-histone proteins. Gene. 363, 15-23 (2005).
  17. Close, P., et al. The emerging role of lysine acetylation of non-nuclear proteins. Cell Mol Life Sci. 67 (8), 1255-1264 (2010).
  18. Iyer, A., Fairlie, D. P., Brown, L. Lysine acetylation in obesity, diabetes and metabolic disease. Immunol Cell Biol. 90 (1), 39-46 (2012).
  19. You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. Lysine acetylation: enzymes, bromodomains and links to different diseases. Essays Biochem. 52, 1-12 (2012).
  20. Bonnaud, E. M., Suberbielle, E., Malnou, C. E. Histone acetylation in neuronal (dys)function. Biomol Concepts. 7 (2), 103-116 (2016).
  21. Fukushima, A., Lopaschuk, G. D. Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure. Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).
  22. Kaypee, S., et al. Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics. Pharmacol Ther. 162, 98-119 (2016).
  23. Tapias, A., Wang, Z. Q. Lysine Acetylation and Deacetylation in Brain Development and Neuropathies. Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).
  24. Hu, L. I., Lima, B. P., Wolfe, A. J. Bacterial protein acetylation: the dawning of a new age. Molecular microbiology. 77 (1), 15-21 (2010).
  25. Jones, J. D., O’Connor, C. D. Protein acetylation in prokaryotes. Proteomics. 11 (15), 3012-3022 (2011).
  26. Bernal, V., et al. Regulation of bacterial physiology by lysine acetylation of proteins. New biotechnol. 31 (6), 586-595 (2014).
  27. Hentchel, K. L., Escalante-Semerena, J. C. Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress. Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).
  28. Ouidir, T., Kentache, T., Hardouin, J. Protein lysine acetylation in bacteria: Current state of the art. Proteomics. 16 (2), 301-309 (2016).
  29. Wolfe, A. J. Bacterial protein acetylation: new discoveries unanswered questions. Curr Genet. 62 (2), 335-341 (2016).
  30. Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. Autoacetylation of the histone acetyltransferase Rtt109. J Biol Chem. 286 (28), 24694-24701 (2011).
  31. Neumann, H., Peak-Chew, S. Y., Chin, J. W. Genetically encoding Nε-acetyllysine in recombinant proteins. Nat chem biol. 4 (4), 232-234 (2008).
  32. Fan, C., Xiong, H., Reynolds, N. M., Soll, D. Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids. Nucleic Acids Res. 43 (22), e156 (2015).
  33. Bryson, D., et al. Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity. Nat Chem Biol. , (2017).
  34. Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. Studying the Lysine Acetylation of Malate Dehydrogenase. J Mol Biol. 429 (9), 1396-1405 (2017).
  35. Venkat, S., Gregory, C., Gan, Q., Fan, C. Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli. Chembiochem. 18 (19), 1928-1934 (2017).
  36. Liu, C. C., Schultz, P. G. Adding new chemistries to the genetic code. Annu Rev Biochem. 79, 413-444 (2010).
  37. Mukai, T., Lajoie, M. J., Englert, M., Soll, D. Rewriting the Genetic Code. Annu Rev Microbiol. , (2017).
  38. O’Donoghue, P., Ling, J., Wang, Y. S., Soll, D. Upgrading protein synthesis for synthetic biology. Nat Chem Biol. 9 (10), 594-598 (2013).
  39. Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem. 83, 379-408 (2014).
  40. O’Donoghue, P., et al. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion. FEBS Lett. 586 (21), 3931-3937 (2012).
  41. Aerni, H. R., Shifman, M. A., Rogulina, S., O’Donoghue, P., Rinehart, J. Revealing the amino acid composition of proteins within an expanded genetic code. Nucleic Acids Res. 43 (2), e8 (2015).
  42. Huang, Y., et al. A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli. Mol Biosyst. 6 (4), 683-686 (2010).
  43. Venkat, S., et al. Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli. FEBS Open. , (2017).
  44. Wan, W., Tharp, J. M., Liu, W. R. Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool. Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).
  45. Gregoretti, I. V., Lee, Y. M., Goodson, H. V. Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol. 338 (1), 17-31 (2004).
  46. Weinert, B. T., et al. Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli. Mol cell. 51 (2), 265-272 (2013).

Tags

Site-specific AcetylationProtein AcetylationGenetic Code ExpansionPyrrolysyl-tRNA SynthetaseAmber Stop CodonE. Coli ExpressionSite-directed MutagenesisAcetyllysine Incorporation

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Venkat, S., Gregory, C., Meng, K., Gan, Q., Fan, C. A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli. J. Vis. Exp. (130), e57061, doi:10.3791/57061 (2017).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image