Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

1. Collection of the Transposon Library

NOTE: The chromosomal DARS2 locus was cloned into the mini Tn10-based transposon, NKBOR (on pNKBOR)²¹, resulting in NKBOR::DARS2 (pJFM1). pNKBOR can be obtained online²². pNKBOR is a R6K-based suicide vector that requires the initiator protein π for replication²³. Plasmid pJFM1 is therefore able to replicate in an E. coli strain (e.g., Dh5α λ pir) containing a chromosomal copy of the pir gene. However, when pJFM1 is transformed into the Pir-deficient wildtype MG1655, pJFM1 cannot replicate, leading to the selection of kanamycin-resistant clones generated by the random insertions of NKBOR::DARS2 into the bacterial chromosome. For simplicity, these are referred to as DARS2 insertions. See Figure 1 for a schematic presentation of the methodology.

1. Prepare electrocompetent MG1655 ΔDARS2 from actively growing cells in Lysogeny broth (LB) grown at 37 °C²⁴.
2. Electroporate pJFM1 into electrocompetent MG1655 ΔDARS2, according to Gonzales et al.²⁴
   1. Add 1 µg of pJFM1 (in 1 µL of water) to 40 µL of electrocompetent E. coli MG1655 ΔDARS2 and transfer this mixture to a pre-chilled, sterile 0.2-cm gap cuvette. Insert the cuvette into the electroporation chamber. Electroporate at 18 kV, 500 Ω, and 25 µF; the time constant should be ~5.0 ms, and no arcing should occur.
   2. Quickly recover the bacterial suspension by resuspending it in 1 mL of pre-warmed LB broth and transfer to a 15 mL test tube.
   3. Let the cells recover by incubating under aerated growth conditions at 37 °C for 30 min, without antibiotic selection. Plate the bacteria onto LB agar plates supplemented with 50µg/mL kanamycin and incubate at 37 °C overnight.
3. Count the colonies from the electroporation: one colony is considered equal to one chromosomal transposon insertion.
   NOTE: Colonies can be counted by eye or with a colony counter. The number of colonies is inversely proportional to the average distance separating the transposons located in the chromosome of each clone.
4. Add 1 mL of LB broth to each plate and wash off all colonies; 1 mL of LB broth should be sufficient to wash off ~100,000 colonies. Re-use the same 1 mL of LB broth to increase the bacterial concentration. Pool all colonies in the same 50 mL tube.
5. Vortex the tube and freeze the start material (t = 0). To freeze it, mix 1 mL of cell suspension with 1 mL of 50% glycerol on ice. Transfer the tubes to dry ice for 10 min. Once the cultures are frozen, transfer them to a -80 °C freezer.
   NOTE: A cell concentration of a minimum of 50,000 CFU/mL is expected at this step.

2. Competition Experiment in LB

1. Thaw the transposon library from -80 °C on ice. Mix by pipetting.
2. Transfer 100 µL of the transposon library to 10 mL of LB in a 15 mL test tube.
3. Grow the cells, aerated by continuous shaking (250 rpm), for 8 h at 37 °C to stationary phase (i.e., OD₆₀₀ = ~4.0). Adjust these parameters to different growth conditions, as desired.
4. Propagate the bacterial population by continuous transfers into fresh prewarmed medium every ~10 generations. Do this by transferring 10 µL of the previous stationary phase culture to 10 mL of fresh LB and growing for another 8 h to the stationary phase (i.e., OD₆₀₀ = ~4.0).
   NOTE: As the start and end optical density are the same, a 1,000-fold dilution corresponds to ~10 generations of growth (2¹⁰ = 1,024). The bacterial population can either be propagated directly into fresh prewarmed medium or saved at 0-4 °C (on ice) and propagated the following day. LB was used here to ensure as many cellular doublings in as short a time as possible (a doubling time close to 22 min).
5. After each 100 generations of competition, save five 1-mL samples at -80 °C (as described in step 3.3).
6. If the fitness differences between cells containing individual transposon insertions are expected to be small, keep the duration of competition long; here, 700 generations (t = 700) were used.

3. Southern Blot Analysis to Monitor the Competition Experiment Over Time

1. Prepare the probe for the Southern blot (1-kb section of the NKBOR) by performing polymerase chain reaction (PCR) amplification using specific primers: NKBOR_Probe_FW: gatgttggacgagtcggaat and NKBOR_Probe_RV: cgttacatccctggcttgtt.
   1. Incubate at 98 °C for 30 s for initial denaturation. Then, perform 35 cycles at 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 45 s. For the final extension, use 72 °C for 10 min.
      NOTE: The template for the PCR reaction was a purified pNKBOR plasmid²¹.
   2. Label the resultant PCR fragment with [α-32P]dATP using the random primer system, according to Smith²⁵.
2. Prepare the total cellular DNA according to Løbner-Olesen and von Freiesleben²⁶ for t = 0 and selected time points until t = 700 estimated generations of competition.
3. Digest the total cellular DNA with PvuI, which cuts the NKBOR containing the region of interest once only in a region not covered by the probe; 1 unit of PvuI can be used to completely digest 1 µg of substrate DNA.
   NOTE: The probe will recognize fragments containing part of the transposon, along with chromosomal DNA of various lengths, depending on the insertion site.
4. Perform a Southern blot using a 0.7% agarose gel according to Løbner-Olesen and von Freiesleben²⁶.

4. Identification of the Fittest Clones

1. Use easy gene walking, as described by Harrison et al.²⁷, to identify DARS2 insertion sites from single clones (isolated on LB plates) after 700 estimated generations of competition; the more bands on the Southern blot, the more isolates are needed to cover all transposon insertions.
   1. Isolate genomic DNA for PCR template. Spread bacteria on an LB agar plate containing 50 µg/mL kanamycin and incubate at 37 °C overnight. Grow single colonies overnight in LB broth at 37 °C and subsequently transfer 20 µL into 200 µL of autoclaved distilled water (or use DNA purification, as in step 3.2).
      1. Vortex to mix. Heat the mix at 100 °C for 10 min and centrifuge at max speed for 5 min. Save the cell lysate at -20 °C for future use.
   2. Design three nested primers to anneal within the transposon of choice (see Figure 2 for a graphic representation of the PCR strategy).
      NOTE: Designing Nested Primers should ensure that Nested Primer 3 lies closest to the known 5' end of the transposon DNA, followed by Nested Primers 2 and 1. The spacing between Nested Primer 3 and the 5' end of the known transposon DNA should be sufficient for a sequence read-through from the known DNA to the unknown DNA (to find the specific chromosomal transposon insertion site). For NKBOR the following nested primers were used: pNKBOR_Nested3_RV: gcagggctttattgattcca, pNKBOR_Nested2_RV: tcagcaacaccttcttcacg, and pNKBOR_Nested1_RV: actttctggctggatgatgg. Random primers containing the recognition sites of known restriction enzymes are also used. To ensure a result, one should use at least two different random primers. The restriction sites for the restriction enzymes (e.g.,Sau3AI and HindIII) should be located at the 3' end and preceded by ten random bases so that 5'-NNNNNNNNNNGATC-3' and 5'-NNNNNNNNNNAAGCTT-3' are the primers containing a Sau3AI site (GATC) and a HindIII site (AAGCTT), respectively, where N = A, T, G, or C.
   3. Use 200 ng of genomic DNA in a 20 µL PCR reaction. Incubate at 98 °C for 30 s for the initial denaturation. Perform 25 cycles at 98 °C for 30 s, 50 °C for 15 s, and 72 °C for 4 min. For the final extension, use 72 °C for 10 min. Use primer pairs consisting of Nested Primer 1 and one of the random primers.
   4. Use primer pairs consisting of Nested Primer 2 and the same random primer from the second amplification, using 1 µL of its previous reaction as a template.
   5. Repeat step 4.1.4 with primer pairs consisting of Nested Primer 3 and the same random primer.
   6. Run the products from the final PCR reaction on a 1.5% agarose gel and stain with ethidium bromide. Cut out a band in the range 100-800 bp and isolate the DNA using any commercial DNA gel extracting kit according to the manufacturer's direction. Resuspend the DNA in 15 µL of water.
      NOTE: Caution. Ethidium bromide is toxic and must be handled with care.
   7. Sequence the band isolated in the previous step (step 4.1.6), with Nested Primer 3 as the sequencing primer, using Sanger sequencing at a commercial provider.
2. Perform WGS.
   1. Perform WGS on the total DNA extracted from selected samples collected during the competition experiment, as described by Frimodt-Møller et al⁴.
3. Perform sequencing analysis.
   1. Align paired-end reads to 150 Ns contiguous to NKBOR, AF310136.1 1,904…2,204 using Bowtie2²⁸ with an interval between seed substrings (S,1,1.15) and a maximum number of ambiguous characters (L,0,0.9).
   2. Select the aligned reads and then re-align to both MG1655 ref|NC_000913.3 and NKBOR gb|AF310136 using blastN²⁹
   3. Assign transposition insertion positions at junctions MG1655-NKBOR.

5. Flow Cytometry

1. Collect samples for flow cytometry.
   1. Balance each culture by maintaining it in the exponential growth phase for at least 10 generations. Check the OD₆₀₀ and ensure that it never exceeds 0.3.
   2. Collect two types of flow samples.
      1. For RIF-runout, transfer 1 mL of culture to a 15 mL tube containing 30 µL of RIF-CEF (300 µg/mL rifampicin and 36 µg/mL cephalexin dissolved in 12.5 mM NaOH). Leave it at 37 °C for a minimum of 4 h of shaking.
         NOTE: Rifampicin indirectly blocks the initiation of chromosome replication while allowing for ongoing rounds of replication to continue to termination. Cephalexin prevents cell division, which results in replication runout (RIF-runout) and the accumulation of cells with fully replicated chromosomes. The number of fully replicated chromosomes is equal to the number of origins at the time of treatment with rifampicin and cephalexin²⁰.
      2. For the EXP-sample, transfer 1 mL of exponentially growing culture to a 1.5-mL tube on ice.
2. Fix THE cells as follows. Harvest the cells by centrifugation at 15,000 x g for 5 min at 4 °C. Resuspend the pellet in 100 µL of ice-cold 10 mM Tris pH 7.5 and add 1 mL of ice-cold 77% ethanol. Store the samples at 4 °C until use.
3. Stain the cells as follows. Harvest 100-300 µL of fixed cells by centrifugation at 15,000 x g for 15 min. Remove the supernatant and resuspend the pellet in 130 µL of "DNA Staining solution" (90 µg/mL mithramycin, 20 µg/mL ethidium bromide, 10 mM MgCl₂, and 10 mM Tris pH 7.5). Put the samples on ice and in the dark; the samples are ready for flow cytometry analysis after 10 min.
   NOTE: Other DNA stains than ethidium bromide and mithramycin can also be used^30,31.
4. Determine the origin per cell, the relative cell mass, and the relative DNA content by flow cytometry analysis.
   1. Perform flow cytometry, as described previously³². Run RIF-runout and EXP-samples using the flow cytometer manufacturer's instructions. For mithramycin- and ethidium bromide-stained cells, use excitation wavelengths 395 and 440 nm and collect the fluorescence above 565 nm.
      1. To determine the relative cell mass and relative DNA content, run the EXP-samples to obtain single-parameter forward-light scatter versus cell number histograms and fluorescence intensity versus cell number histograms for a minimum of 30,000 events corresponding to the cell signal.
      2. Use forward-scattered light single-parameter distribution to measure the average relative cell mass.
         NOTE: Forward-scattered light is a measure of the average cell mass²⁰.
      3. Use fluorescence intensity single-parameter distributions to measure the average DNA content²⁰.
      4. Obtain the DNA concentration as the ratio of average DNA content to the average cell mass²⁰.
   2. Determine the number of origins per cell.
      1. Run RIF-runout samples to obtain single-parameter fluorescence intensity versus cell number histograms for a minimum of 30,000 events corresponding to the cell signal.
      2. Use fluorescence intensity single-parameter distributions to determine the number of chromosomes in each cell²⁰.
5. Calculate the asynchrony index (Ai).
   1. Calculate the Ai,as described by Løbner-Olesen et al.³², using the fluorescence intensity single parameter distributions of the RIF-runout samples and the formula Ai = (f3 + f5 + f6 + f7) / (f2 + f4 + f8), where fx is the fraction cells with x number of fully replicated chromosomes. Consider initiations asynchronous when A >0.1.