A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer

1. gRNA Design for the CRISPR-concatemer Vector

Note: The aim of this section is to explain how to opt for the best targeting strategy and how to design gRNAs containing specific overhangs for the CRISPR-concatemer vector.

1. Design gRNAs against the genes of interest using a CRISPR gRNA design tool of choice. See the Table of Materials for an example.
   NOTE: When targeting a pair of paralogous genes, although it is possible to design one gRNA per gene, it is advisable to design two gRNAs per gene to increase the chances of achieving a double knockout (Figure 1).
2. Make sure the gRNAs do not contain the BbsI recognition site by using a restriction mapping tool (see the Table of Materials for an example).
3. Add specific CRISPR-concatemer vector overhangs to each oligo, as shown in Table 1.

Table 1: Overhangs for Each Cassette of the CRISPR-concatemer Vector.

2. Cloning of gRNAs into the CRISPR-concatemer Vector

1. Phosphorylation and annealing of oligos
   NOTE: This step illustrates how to anneal top and bottom strands for each gRNA oligo and how to phosphorylate their ends in a single reaction.
   1. Prepare the reaction mixture for phosphorylating oligos and annealing top and bottom strands on ice, per the instructions below.
      NOTE: All oligos can be pooled into one reaction; for example, in the case of a 4 gRNA-concatemer vector, pool together 8 oligos.
   2. For 3 concatemers, use 3.0 µL gRNA top strand (1.0 µL from each gRNA; 10 µM, 1 µL/gRNA), 3.0 µL gRNA bottom strand (1.0 µL from each gRNA; 10 µM, 1 µL/gRNA), 2.0 µL T4 DNA ligase buffer (10x), 1.0 µL T4 PNK, and add H₂O up to total volume of 20.0 µL.
   3. Mix well by pipetting and run this in a thermocycler using the following settings: 37 °C for 30 min, 95 °C for 5 min, ramp down to 25 °C at 0.3 °C/min, hold at 4 °C.
2. BbsI shuffling reaction
   NOTE: In this section, the pre-annealed gRNA oligos are incorporated into the appropriate position of the concatemer vector in one step by alternating cycles of digestion and ligation.
   1. Dilute the reaction mixture 1:100 in DNase/RNase-free water to generate 3 and 4 gRNA-concatemer vectors.
      NOTE: When cloning 2 gRNA-concatemers this step is not needed.
   2. Assemble the BbsI shuffling reaction on ice, per the instructions below. Include a negative control that only contains the vector.
   3. Use 100 ng CRISPR-concatemer vector, 10.0 µL oligo mixture, 1.0 µL BSA-containing restriction enzyme buffer (10x), 1.0 µL DTT (10 mM), 1.0 µL ATP (10 mM), 1.0 µL BbsI, 1.0 µL T7 ligase, and H₂O up to total volume of 20.0 µL.
   4. Mix well by pipetting and run this in a thermocycler using the following settings: Run 50 cycles for cloning 3 and 4 gRNA-concatemers and 25 cycles for 2 gRNA-concatemers, both at 37 °C for 5 min, 21 °C for 5 min, hold at 37 °C for 15 min , then 4 °C forever.
3. Exonuclease treatment
   NOTE: This step is highly recommended as it increases the efficiency of the cloning by removing any traces of linearized DNA.
   1. Treat the BbsI shuffling reaction with a DNA exonuclease (see Table of Materials) as follows.
   2. Take 11.0 µL ligation mix from the previous step (2.2.3), add 1.5 µL exonuclease buffer (10x), 1.5 µL ATP (10 mM), 1.0 µL DNA exonuclease, and bring up total volume to 15.0 µL with water. Incubate at 37 °C for 30 min followed by 70 °C for 30 min.
      NOTE: This step removes any residual linearized DNA in the mixture and so increases the cloning efficiency.
   3. Use 2 µL of the reaction mixture for transformation into chemically competent E. coli bacteria by heat shock¹².
      NOTE: Alternatively, the reaction can be stored for up to one week at -20 °C.
4. Restriction digestion
   NOTE: The aim of this step is to assess by restriction digestion the success of the cloning procedure.
   1. To confirm the presence of gRNA inserts in the CRISPR-concatemer vector, pick 4 – 8 bacterial colonies with an inoculating loop, grow each clone in 4 mL of LB medium overnight at 37 °C in an orbital shaker. Extract DNA using a plasmid miniprep kit according to the manufacturer's instructions (see the Table of Materials).
   2. Digest ~200 ng of DNA with 10 U EcoRI + 5 U BglII in a 10 μL reaction by incubating it at 37 °C for 3 h in a bacteria incubator. Include a separate reaction mixture with the corresponding original vector as a positive control for size comparison.
      NOTE: This will confirm whether all concatemers are present, since these two restriction enzymes will excise whole concatemers. These are the expected sizes for each concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1.2 kbp), and 4 gRNA-concatemer (1.6 kbp).
   3. Run digestion reactions on a 1% agarose gel at 90 V for approximately 20 min.
   4. Visualize the gel using a UV transilluminator. Identify the clones with correct insert size by ensuring their band pattern matches the one of the original vector and that each fragment has the expected size by using a DNA ladder.
   5. Digest the selected clones with 5 U BbsI at 37 °C for 3 h in a bacteria incubator. Include a separate reaction mix with the corresponding original vector as a control.
      NOTE: This additional digestion step is to confirm that gRNAs have been cloned into the right position and consequently all BbsI recognition sites have been lost.
   6. Run digestion reactions on a 1% agarose gel at 90 V for approximately 20 min. Consider as correct only the vectors that are not cut by BbsI as they only contain gRNAs.
5. Vector sequencing
   NOTE: The aim of this step is to confirm the presence of gRNA sequences in those vectors identified as correct by restriction digestion analysis.
   1. Confirm positive concatemer vectors by Sanger sequencing¹³ using the following primers:
      Forward: TCAAGCCCTTTGTACACCCTAAG (for checking the first gRNA cassette)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (for checking the second gRNA cassette)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (for checking the second gRNA cassette)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (for checking the third gRNA cassette)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (for checking the third gRNA cassette)
      Reverse: AGGTGGCGCGAAGGGGCCACCAAAG (for checking the last gRNA cassette)
   2. Check the presence of all gRNA by searching their sequences in the sequencing reads.

3. Transfection of Intestinal Organoids by Electroporation

NOTE: Please note that this procedure is based on the protocol published by Fujii et al. in 2015, with adaptation for mouse small intestinal organoid cultures¹⁴.

1. Pre-electroporation
   NOTE: This section describes how to prepare the mouse intestinal organoids prior to electroporation by removing all antibiotics and conditioned media from their culture medium. This will prevent possible toxic effects during electroporation.
   1. On day 0 of the transfection procedure, split organoids in a 1:2 ratio.
      NOTE: Intestinal organoid cultures can be obtained by performing crypt isolation according to previously established protocols¹⁵. Please refer to Table 2 for all media compositions.
      1. When splitting organoids for electroporation, seed a minimum of 6 wells of a 48-well plate per transfection.
      2. Seed the organoids in 20 μL-basement matrix drops and grow them in WENR + Nic medium (Wnt + EGF + Noggin + R-spondin + Nicotinamide) at 37 °C, 5% CO₂ in a humidified incubator (as previously described¹⁵).
   2. On day 2, change medium by replacing WENR+Nic with 250 µL of EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3 inhibitor) + Y-27632 (ROCK inhibitor), without antibiotics (see Table 2).
      NOTE: In all the steps, the quantity of medium added to each well of a 48-well plate is 250 µL.
   3. On day 3, change the organoid medium to EN + CHIR99021 + Y-27632 + 1.25% v/v Dimethyl sulfoxide (DMSO), without antibiotics.
2. Preparation of the cells
   NOTE: Here we describe how to fragment organoids into small cell clusters by mechanical and chemical dissociation. These steps are critical to the success of the procedure.
   1. On day 4, disrupt the basement matrix domes using a 1 mL pipette tip and transfer organoids to a 1.5 mL tube. Pool contents of four wells of a 48-well plate into a tube.
   2. Mechanically break organoids into small fragments by pipetting up and down with a P200 pipette approximately 200 times. Centrifuge at room temperature, 5 min at 600 x g.
   3. Remove the medium and resuspend the pellet in 1 mL of a cell culture grade recombinant protease (see table of materials). Incubate at 37 °C for a maximum of 5 min and then check a 50-µL drop of sample under an inverted light microscope with a 4x objective.
      NOTE: Clusters of 10 – 15 cells are desirable, as this increases cell survival after electroporation.
   4. Transfer the cell suspension to a low-binding 15 mL tube and halt the dissociation by adding 9 mL of basal medium without antibiotics (see Table 2). Centrifuge at room temperature, 5 min at 600 x g, then discard the supernatant and resuspend the pellet in 1 mL of reduced serum medium (see Table of Materials).
   5. Count the number of cells with a Bürker's chamber and use a minimum of 1 x 10⁵ cells per electroporation reaction. Add 9 mL reduced serum medium to the 15 mL tube and centrifuge at room temperature, 3 min at 400 x g.
3. Electroporation
   NOTE: The following sections provide instructions on how to perform electroporation and to make organoids recover afterwards.
   1. Remove all of the supernatant and resuspend the pellet in an electroporation solution (see Table of Materials). Add a total amount of 10 µg DNA to the cell suspension and add electroporation solution to a final volume of 100 µL and keep the cell-DNA mixture on ice. Use CRISPR-concatamer vectors in combination with a Cas9 expression plasmid (e.g. Addgene #41815) in a 1:1 ratio.
      NOTE: The total volume of the DNA added should be less than or equal to 10% of the total reaction volume.
   2. Include a separate transfection mix containing a GFP plasmid to evaluate transfection efficiency (e.g. pCMV-GFP, Addgene #11153, or any generic GFP-expressing plasmid).
   3. Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ. Perform electroporation according to the settings shown in Table 3.
      NOTE: If the impedance value falls outside of the allowed range, adjust the solution volume in the cuvette.
   4. Add 400 µL of electroporation buffer + Y-27632 to the cuvette and then transfer all to a 1.5 mL tube. Incubate at room temperature for 30 min to allow cells to recover and subsequently spin them at room temperature for 3 min at 400 x g.
   5. Remove the supernatant and resuspend the pellet in 20 μL/well of basement matrix. Seed approximately 1 x 10⁴ to 1 x 10⁵ cells per well in a 48-well plate and add EN + CHIR99021 + Y-27632 + 1.25% v/v DMSO medium. Incubate at 37 °C.
   6. On day 5, change the medium to EN + CHIR99021 + Y-27632, and check transfection efficiency by observing GFP expression (Figure 2). Keep organoids at 37 °C and refresh EN + CHIR99021 + Y-27632 medium after 2 days.
   7. On day 9, change the medium to WENR + Nic + Y-27632 and incubate at 37 °C.
      NOTE: Y-27632 can be removed after 7-10 days (on day 16-19).

Table 3: Electroporation Settings.

4. Growth Factor Withdrawal

Note: Here it is exemplified how to conduct a growth factor withdrawal experiment when knocking out negative regulators of the Wnt pathway in intestinal organoids.

1. 10-14 days after electroporation, split the organoids in a 1:3 ratio in a 48-well plate following the above-mentioned steps (3.2.1 – 3.2.2).
2. Resuspend the organoid pellet in 20 µL of basement membrane matrix and let it solidify at 37 °C for 10 min. Then, overlay 250 µL of growth factor-deprived medium (e.g. EN) to test whether knockout of the target genes has been achieved⁵.
3. Split the organoids under growth factor-deprived conditions for a minimum of 2 – 3 passages to see a difference in survival between wild type wildtype (WT) control organoids and mutant organoids^5,15.
   NOTE: Wildtype organoids should not be able to survive in growth factor-deprived medium over two passages, while mutant lines should be able to grow.