Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

1. Construction of Expression Vectors

1. Use PCR Infusion cloning to construct up to 96 expression plasmids in parallel using the vectors pOPINE-3C-GFP and pOPIN-N-GFP which add either cleavable C-terminal or N-terminal GFP-His6 fusions to the sequences¹³ respectively.
   Note: The choice of vector is dictated by the topology of the protein since the GFP needs to be expressed in the cytosol, thus for a protein with a cytosolic N-terminus and extracellular C-terminus we would use pOPIN-N-GFP and for an extracellular N-terminus and cytosolic C-terminus in we would use pOPINE-3C-GFP. Where both termini are cytosolic we would use pOPINE-3C-GFP unless there is functional reason not to tag the C-terminus.
2. Amplify the DNA sequences encoding the membrane proteins with primers incorporating the following extensions shown:
   pOPINE-3C-GFP (Forward primer — AGGAGATATACCATG; Reverse primer — CAGAACTTCCAGTTT) and pOPIN-N-GFP (Forward primer — AAGTTCTGTTTCAGGGCCCG; Reverse primer — ATGGTCTAGAAAGCTTTA).
3. Analyze the PCR reaction by agarose gel electrophoresis. Once clean PCR products have been obtained, add 5 U DpnI to each well (make up in 5 µl of 1x DpnI reaction buffer). Purify the PCR products using magnetic beads in a 96-well format.
   Note: DpnI is added to remove the template vector; this step is not necessary if genomic DNA is used as template.
4. Add 1 μl (100 ng) of the appropriate linearized vector to each well of a PCR plate.
5. Using a multichannel pipettor add x μl of purified PCR insert to the appropriate wells of the PCR plate. Ensure that all products are in the range of 10-250 ng.
6. Add (9-x) μl of water to the well and transfer the whole 10 μl to a tube containing the dry-down in-fusion reagent. Leave for 30 sec.
7. Mix contents briefly by pipetting up and down. Transfer the reactions back to the original PCR plate and seal.
8. Incubate for 30 min at 42 °C in a thermocycler.
9. Immediately transfer the reactions to ice as soon as the reaction is complete and add 40 μl of TE (10 mM Tris, pH 8.0, 1 mM EDTA).
10. Freeze at once or transform into competent cells. For transformation, use 3 µl of the diluted reaction per 50 μl aliquot of high competency (> 5 x 10⁹ transformants/µg) competent E. coli cells.
11. Add 1 ml of LB agar supplemented with 50 µg/ml carbenicillin per well of a 24-well tissue culture plate (for cloning, prepare wells for 2 x number of constructs).
12. Following outgrowth, Following outgrowth plate out 25 μl and 25 μl of a 1 in 5 dilution of the culture onto the agar containing 24-well tissue culture plates.
13. Spread the cells by gently tilting the plate.
14. Dry the plate with the lid off for 10-15 min at 37 °C or in a flow hood at room temperature.
15. Replace the lid and turn the plate upside down and incubate overnight at 37 °C.
16. Pick two colonies and mini-prep the vectors.
17. PCR verify the constructs using the construct specific reverse primer and a vector specific forward primer (e.g. pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA TAG GG).

2. Transformation of E. coli Expression Strains

Note: Prior to performing this protocol, E. coli competent cells are made, aliquotted and stored frozen at -80 °C as described previously¹³. Membrane protein expression is routinely screened in two strains, Lemo21(DE3) and C41(DE3)pLysS. To aid interpretation of the results it can be helpful to include a positive control, e.g. a plasmid expressing GFP or a membrane protein fused to GFP known to express and an empty vector negative control.

1. Thaw the aliquotted E. coli on ice. Add 3 µl of mini-prepped expression plasmid to each aliquot of competent cells.
2. Incubate the mix on ice for 30 min.
3. Heat-shock the cells for 30 sec at 42 °C.
4. Allow cells to recover on ice for 2 min and then add 300 µl of power broth to each tube.
5. Incubate for 1 hr in a 37 °C static incubator.
6. Prepare the LB Agar in a 24-well tissue culture plate, supplemented with 50 µg/ml carbenicillin and 35 µg/ml chloramphenicol. Add rhamnose to a final concentration of 0.25 mM to the wells containing Lemo21 (DE3).
   Note: If the product is likely to be toxic the wells containing C41(DE3) pLysS can be supplemented with 1% (w/v) glucose.
7. Transfer 30 µl of cells from the transformation mix onto the LB Agar plates. Spread and dry the plate as described in 1.13-1.15.

3. Preparation of Overnight Starter Cultures

Note: Always prepare overnight cultures the day after transformation never from an old transformation plate.

1. Add 0.7 ml power broth to each well of a 96-well deep-well plate supplemented with 50 µg/ml carbenicillin and 35 µg/ml chloramphenicol. Add rhamnose to the wells containing Lemo21 (DE3) to a final concentration of 0.25 mM. Optionally, supplement C41(DE3) pLysS with 1% (w/v) glucose; see above (2.6 note).
2. Pick one colony from the overnight transformation plates into each well. Seal the block with a gas-permeable seal.
3. Shake the block at 250 rpm in an incubator with a large throw (e.g. a 25 mm orbit) or at 600 rpm in an incubator with a small throw (e.g. a 4.3 mm orbit) at 37 °C overnight.

4. Growth and Induction of Cultures

1. Add 3 ml of power broth supplemented with 50 µg/ml carbenicillin and 35 µg/ml chloramphenicol to each well of 24-well deep-well plate. Add L-rhamnose (and glucose) as described in section 3.1. Use 3 ml of culture to allow harvesting in duplicate and to allow for some evaporation of water through the gas permeable seal.
2. Set up the expression cultures by adding 150 µl of Lemo21 (DE3) or C41(DE3) pLysS overnight cultures to each well of the 24-well deep-well blocks.
3. Shake the blocks at 37 °C until the average O.D. at 595 nm is ~0.5 through the plate.
4. Induce expression by adding IPTG to the cultures to a final concentration of 1.0 mM IPTG.
5. Grow the cultures overnight (18-20 hr) with shaking at 20 °C.

5. Analysis of Expression by In-gel Fluorescence

1. Harvest in duplicate. Transfer 1 ml of culture from each well into a square well, conical bottom, 96-well deep-well block.
   Note: Harvest in duplicate in case of breakage of the block or to allow the testing of an alternative detergent if desired.
2. Seal the blocks and harvest the cells by centrifugation at 6,000 x g for 10 min.
3. Invert the block and decant the media. Tap the block gently onto a paper towel to drain remaining media.
4. Seal the plates and store at -80 °C for a minimum of 20 min. Optionally, leave the experiment at this point and the block processed when convenient.
5. De-frost the pellets for 20 min at room temperature.
6. Use either a multi-channel pipette or an orbital shaker (1,000 rpm for 10 min) at 4 °C to resuspend the cells completely in 200 µl of lysis buffer (50 mM NaH₂PO₄, 300 mM NaCl 10 mM Imidazole 1% v/v Tween 20, adjust the pH to 8.0 using NaOH).
7. Add 20 µl of the DLPI solution (20 µl DNaseI (4,000 units/ml), 20 mg lysozyme, and 20 µl protease inhibitor cocktail in a final volume of 2 ml of water). Incubate for 10 min with shaking (~1,000 rpm) at 4 °C.
8. Add 25 µl of 10% n-Dodecyl β-D-maltoside (DDM).
9. Incubate for 60 min with shaking (~1,000 rpm) at 4 °C.
10. Centrifuge the deep-well block at 6,000 x g for 30 min at 4 °C.
11. Transfer 10 μl of the cleared lysate to a microtitre plate and add 10 μl of SDS PAGE gel loading buffer (100 mM Tris, pH 6.8, 4% w/v SDS, 0.2% w/v Bromophenol blue, 10% v/v β-mercaptoethanol, and 20% v/v glycerol). CAUTION! DO NOT BOIL THE SAMPLE.
12. Load 10 μl of sample from step 5.11/well onto SDS PAGE gel(s) and run at 100-120 V (constant voltage) in a cold room until the dye front reaches the bottom (2-2.5 hr).
13. Place the gel onto an imager (e.g. with a blue-light filter to detect the GFP fusion proteins). The exposure time is chosen to ensure that the brightest bands are not saturated.

6. Scale-up of Cell Cultures

1. Transform an aliquot of competent E. coli as described in section 2.
2. Pick a colony into 10 ml of power broth (supplemented as described in section 3) and grow overnight at 37 °C.
3. Dilute 5 ml of the overnight culture into 500 ml power broth.
4. Grow with shaking at 250 rpm at 37 °C until the O.D. at 595 nm is ~0.5.
5. Induce expression by adding IPTG to a final concentration of 1.0 mM.
6. Grow overnight with shaking at 250 rpm at 20 °C.
7. Harvest cells by centrifugation at 5,000 x g for 15 min.
8. Discard supernatant. Cell pellets can be stored at -80 °C.

7. Preparation of Membranes

1. Thaw cells (if necessary) at room temperature and resuspend in 1x PBS pH 7.5 at a volume of 5ml per gram of cell pellet; Increase volume as necessary until viscosity reduces to a runny consistency. Add MgCl₂ to final concentration of 1 mM, DNAse I to final concentration of 10 μg/ml and one pre-packaged protease inhibitor tablet per 20 g of cell pellet. Break open cells using a chilled cell disrupter at a pressure of 30 kpsi.
2. Pellet the unbroken cells and debris at 30,000 g for 15 min at 4 °C. Transfer supernatant to an ultra-centrifugation tube.
3. Collect the total membrane fraction by spinning down the supernatant in an ultra-centrifuge at 200,000 x g for 1 hr at 4 °C.
4. Discard the supernatant.
5. Re-suspend the membrane pellet in ice-cold 10 ml PBS pH 7.5 using a cell homogenizer. 1 ml resuspended membranes are required for each detergent. Optionally, at this stage, flash freeze the membrane suspension in liquid nitrogen and store at -80 °C.

8. Solubilization and Analysis of the Membrane Fraction

1. Thaw membrane fraction (if necessary), and for each detergent to be used for solubilization, aliquot 900 µl of the membrane suspension into a 1.5 ml polyallomer micro-centrifuge tube.
2. Add 100 µl of each freshly prepared detergent (10% w/v solutions of DDM, DM, Cymal-6 and LDAO) to a final concentration of 1% to the specified 1.5 ml tube. For solubilization of eukaryotic membrane proteins cholesterol hemisuccinate (0.2% final concentration) can be added to the detergents.
3. Incubate the mixtures at 4 °C for 1 hr with mild agitation.
4. Pellet the detergent insoluble fraction with a bench top ultra-centrifuge, ensuring tubes are at least half-full, at 150,000 g at 4 °C for 45 min and retain supernatant.
   Note: The effectiveness of detergent solubilization can be estimated using a fluorescent plate reader by measuring the GFP fluorescence of the solubilized membranes with the detergent insoluble fraction resuspended in the same volume of PBS.
5. Analyze the mono-dispersity of the different detergent : membrane protein complexes using fluorescence-detected size exclusion chromatography (FSEC).
6. For FSEC analysis, equilibrate a size exclusion column with a broad fractionation range, e.g. 5,000 to 5,000,000 in molecular weight, with running buffer (20 mM Tris pH 7.5, 150 mM NaCl, 0.03% DDM) at a flow rate of 0.3 ml/min. Use this buffer for all samples, i.e. it is not changed for each detergent tested.
7. Inject 100 µl of solubilized membranes onto the column at a flow rate of 0.3 ml/min. Monitor elution profile using fluorescence optics (excitation at 488 nm and emission at 512 nm). If an inline fluorescence monitor is not available, collect the fractions and read the fluorescence in a plate reader.
8. Import elution volume and fluorescence intensity data into a spreadsheet program for graphical display.
9. Analyse remaining solubilized membrane material by in-gel fluorescence as described in section 5.