Source: Cao, Y., et al. A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters. J. Vis. Exp. (2016)
In this video, we demonstrate the duplex digital PCR (ddPCR) technique — a modification of the traditional PCR technique that is useful in detecting two different genetic markers simultaneously. A single PCR reaction is partitioned into nanoliter-sized emulsified droplets that are independently amplified, and the detection of differently colored fluorescence amplification signals from the fraction of droplets is used to compute the initial concentration of the target sequences.
1. Assay Mixture Preparation
2. Droplet Generation and PCR Plate Setup
3. Thermal Cycling and Droplet Reading
The authors have nothing to disclose.
Low Bind Microtubes | Costar | 3207 | For storage of reagents, samples/production of master mixes |
Nuclease-Free Water | FisherSci | BP2484-50 | |
TE pH 8 buffer | FisherSci | BP2473-100 | |
Hardshell 96-Well Plate | BioRad | HSP-9601 | For initial master mix and sample inoculation |
Aluminium Sealing Film | BioRad | 359-0133 | To seal sample plate |
Droplet Generator | BioRad | 186-3002 | |
Droplet Generation Oil | BioRad | 186-3005 | |
Cartridge | BioRad | 186-4008 | |
DG8 Cartridge Holder | BioRad | 186-3051 | |
Gasket | BioRad | 186-3009 | |
20uL pipette tips | Rainin | GP-L10F | For tansferring sample/master mix to cartidge |
200uL pipette tips | Rainin | GP-L200F | For transferring droplets to final Twin.Tec Plate |
Twin.Tec 96-Well Plate | Eppendorf | 951020320 | For final droplets thermal cycling and reading |
Pierceable Heat Seal Foil | BioRad | 181-4040 | To seal Twin.Tec plate before thermal cycling |
PX1 PCR Plate Sealer | BioRad | 181-4000 | Only the thermal cycler is needed, no optics |
CFX96 Thermal cycler | BioRad | CFX96 and C1000 | |
QX100 Droplet Reader | BioRad | 186-3001 | |
Droplet Reader Oil | BioRad | 186-3004 | |
Droplet PCR Supermix | BioRad | 186-3024 | i.e. the digital PCR mix in manuscript |
QuantaSoft software (v1.3.2) | Quantasoft | QX100 | For viewing, analyzing, and exporting ddPCR data |
Entero Forward Primer (Ent F1A) | Operon | GAGAAATTCCAAACGAACTTG | Alternative vendor can be used |
Entero Reverse Primer (Ent R1) | Operon | CAGTGCTCTACCTCCATCATT | Alternative vendor can be used |
Entero Probe (GPL813TQ) | Operon | [6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1] | Alternative vendor can be used, but the fluorophore has to be FAM |
HF183 Forward Primer (HF183-1) | Operon | ATCATGAGTTCACATGTCCG | Alternative vendor can be used |
HF183 Reverse Primer (BthetR1) | Operon | CGTAGGAGTTTGGACCGTGT | Alternative vendor can be used |
HF183 Probe (BthetP1) | Operon | [6-HEX]-CTGAGAGGAAGGTCCCCC ACATTGGA-[BHQ1] |
Alternative vendor can be used, but the fluorophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.) |
Positive control | Mixture of E.faecalis genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalis and sequences of the ordered HF183 plasmid, please see Cao et al. 2015 (doi:10.1016/j.watres.2014.12.008). Commercially available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA. |