כאן מוצג פרוטוקול לביצוע וניתוח הקשירה, הניידות וההרכבה של מולקולות בודדות על ממברנות שומנים מלאכותיות צפופות באמצעות מיקרוסקופיה פלואורסצנטית של השתקפות פנימית כוללת של מולקולה אחת (smTIRF).
ממברנות תאיות הן סביבות צפופות מאוד לתגובות ביומולקולריות ולאיתותים. עם זאת, רוב הניסויים במבחנה החוקרים אינטראקציה של חלבונים עם שומנים משתמשים בממברנות דו-שכבתיות עירומות. מערכות כאלה חסרות את המורכבות של צפיפות על ידי חלבונים וגליקנים המוטמעים בממברנה ואינן כוללות את השפעות הנפח הנלוות על פני השטח של קרום התא. כמו כן, משטח הזכוכית הטעון שלילית שעליו נוצרים דו-שכבתי השומנים מונע דיפוזיה חופשית של ביומולקולות טרנסממברנות. כאן אנו מציגים ממברנה פולימרית-שופתית המאופיינת היטב כחיקוי של ממברנות שומנים צפופות. פרוטוקול זה משתמש בשומנים מצומדים מפוליאתילן גליקול (PEG) כגישה כללית לשילוב קראודרים בשכבת השומנים הנתמכת (SLB). ראשית, מוצג הליך ניקוי של השקופיות והכיסויים המיקרוסקופיים לביצוע ניסויים במולקולה בודדת. לאחר מכן, נדונו שיטות לאפיון PEG-SLBs וביצוע ניסויים של מולקולות בודדות של קשירה, דיפוזיה והרכבה של ביומולקולות באמצעות מעקב אחר מולקולות בודדות ופוטו-הלבנה. לבסוף, פרוטוקול זה מדגים כיצד לנטר את מכלול הננו-נקבוביות של רעלן יוצר נקבוביות חיידקים ציטוליזין A (ClyA) על ממברנות שומנים צפופות באמצעות ניתוח פוטו-לבנה של מולקולה אחת. קודי MATLAB עם מערכי נתונים לדוגמה כלולים גם כדי לבצע חלק מהניתוחים הנפוצים כגון מעקב אחר חלקיקים, חילוץ התנהגות מפוזרת וספירת תת-יחידות.
קרומי התאים הם מערכות צפופות ומורכבות מאוד1. לצפיפות מולקולרית יכולה להיות השפעה ניכרת על דיפוזיה של ישויות הקשורות לממברנה כמו חלבונים ושומנים 2,3,4. באופן דומה, תגובות דו-מולקולריות על ממברנות שומניות כמו דימריזציה של קולטנים או אוליגומריזציה של קומפלקסים של ממברנות מושפעות מצפיפותשל 5,6,7. האופי, התצורה והריכוז של ה-crowders יכולים לשלוט בקשירת הממברנה, בדיפוזיביות ובאינטראקציה בין חלבון לחלבון בכמה דרכים 8,9. מאחר שקשה לשלוט בצפיפות הממברנות התאי ולפרש את השפעתן על ביומולקולות משובצות, חוקרים ניסו ליצור מערכות חוץ גופיות חלופיות 10.
גישה פופולרית עבור ממברנות צפופות מלאכותיות היא סימום הממברנות הדו-שכבתיות בפולימר (כגון פוליאתילן גליקול, PEG) – שומנים מושתלים11,12. במהלך הדמיה של דינמיקה של חלבונים ושומנים על דו-שכבתיות שומנים נתמכות (SLBs), פולימרים אלה גם מגנים על הרכיבים המוטבעים בממברנה מפני המצע הטעון שלילית הבסיסי (כגון זכוכית) על ידי הרמה יעילה של הדו-שכבה הרחק מהתמיכה הבסיסית. על ידי שינוי הגודל והריכוז של הפולימר, ניתן לשלוט במידת הצפיפות המולקולרית, כמו גם בהפרדתו מהתמיכה המוצקההבסיסית 13,14. זהו ללא ספק יתרון על פני דו-מולקולות של שומנים הנתמכים על מצעים מוצקים ללא כריות פולימריות15,16, שבהן ביומולקולות טרנס-ממברנה יכולות לאבד את פעילותן17,18,19. חשוב מכך, הוא מאפשר לנו לשחזר את הסביבה הצפופה של קרום התא במבחנה, שהיא קריטית לתהליכי ממברנה רבים.
פולימרים המושתלים על פני השטח על ממברנות עוברים גם שינויים בתצורתם בהתאם לצפיפות ההשתלהשלהם 12. בריכוזים נמוכים, הם נשארים בתצורה מפותלת אנטרופית, המכונה פטריה, מעל פני הממברנה. עם הריכוז הגובר, הם מתחילים לקיים אינטראקציה ונוטים להתפרק ולהתרחב, ולבסוף מניבים היווצרות צפופה דמוית מברשת על הממברנה21. מכיוון שהמעבר מפטרייה למשטר המברשת הוא הטרוגני מאוד ומתבטא בתנאים לא מאופיינים היטב של הפולימר, חשוב להשתמש בתנאים מאופיינים היטב לצפיפות על ממברנות מושתלות בפולימר. בהשוואה למחקרשנערך לאחרונה 20, אנו מזהים ומדווחים על הרכבי ממברנות צפופים השומרים על ההובלה והפעילות הדיפוזית של ביומולקולות טרנסממברניות.
בפרוטוקול זה אנו דנים כיצד ליצור ממברנות שומנים PEGylated ומספקים המלצות לציפותי PEG המחקים צפיפות בשני משטרים שונים של תצורת פולימרים (כלומר, פטריות ומברשת). הפרוטוקול מתאר גם קשירה של מולקולה בודדת, מעקב אחר חלקיקים ואיסוף וניתוח נתוני פוטו-הלבנה עבור מולקולות המוטבעות בממברנות צפופות אלה. ראשית, אנו מתארים את שלבי הניקוי היסודי, את הרכבת תא ההדמיה ואת יצירת PEG-SLBs. שנית, אנו מספקים פרטים לניסויים של קשירת מולקולה בודדת, מעקב אחר חלקיקים ופוטו-הלבנה. שלישית, נדון ב-א) חילוץ זיקות הקשירה היחסיות, ב) אפיון הדיפוזיה המולקולרית, ו-ג) ספירת תת-יחידות במכלול חלבונים מסרטים של מולקולות בודדות על הממברנה.
בעוד שאפיינו את המערכת הזו בהדמיה של מולקולה בודדת, הפרוטוקול שימושי לכל הביופיזיקאים של הממברנות המעוניינים להבין את השפעת הצפיפות על תגובות ביומולקולריות על ממברנות שוממניות. בסך הכל, אנו מציגים צינור חזק לייצור דו-שכבתיות שומנים צפופות ונתמכות, יחד עם בדיקות שונות של מולקולות בודדות הנערכות עליהם ושגרות הניתוח המתאימות.
כאן אנו מדגימים ניסויים של מולקולות בודדות על דו-מולקולות נתמכות של שומנים (SLBs) שמפגינים סביבה צפופה עבור ביומולקולות משובצות ממברנה. הסביבה הצפופה יוצרת אפקט נפח מוחרג, המוביל לשיפור התגובות הביומולקולריות 1,2,39,40. עבו?…
The authors have nothing to disclose.
המחברים מודים לפרופ’ בנימין שולר על שיתוף הביטוי פלסמיד לחלבון ClyA. עבודה זו נתמכה על ידי תוכנית המדע של הגבול האנושי (RGP0047-2020).
2.5 ml Syringes | HMD Healthcare | Dispo Van, 2.5 ml Tuberculin | Plastic syringe |
Acetone | Finar Chemicals | 10020LL025 | |
Acrylic Sheet | 2 mm thick | ||
Acrylic Sheet | BigiMall | 2 mm, Clear | |
Bath Sonicator | Branson | CPX-1800 | |
Calcium Chloride | |||
Chloroform | Sigma | 528730 | HPLC grade |
Cholesterol | Avanti | 700100 | |
Coplin Jar | Duran Wheaton Kimble | S6016 | 8 Slide Jar with Glass Cover |
Coverslips | VWR | 631-1574 | 24 mm X 50 mm |
Cy3-DNA Strand | IDT | GCTGCTATTGCGTCCGTTTGGTT GGTGTGGTTGG-Cy3 |
|
Cyanine Dye (Cy3) | Cytiva Life Sciences | PA23001 | |
DiI | Invitrogen | D3911 | Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3))) |
DNA Connector Strand 1 | Sigma Aldrich | GCTGCTATTGCGTCCGTTTAGCT GGGGGAGTATTGCGGAGGAAGC T |
|
DNA Connector Strand 2 | Sigma Aldrich | CGGACGCAATAGCAGCTCACAG TCGGTCACAT |
|
DNA Tocopherol Strand | Biomers | Toco-CCCAATGTGACCGACTGTGA | |
DOPE-PEG2000 | Avanti | 880130 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) |
Double Sided Tape | 3M | LF93010LE | |
Drill Bits (Diamond Coated) | 0.5 – 1 mm | ||
Drilling Machine | Dremel | 220 | Workstation |
EMCCD | Andor | DU-897U-CS0-#BV | |
Fluorescence Beads | Invitrogen | F10720 | |
Glass Slides | Blue Star | Micro Slides, PIC-1 | |
Glass Vials | Sigma | 854190 | |
Hydrogen Peroxide | Lobachemie | 00182 | 30% Solution, AR Grade |
Labolene | Thermo-Fischer Scientific | Detergent | |
Laser 532 nm | Coherent | Sapphire | |
Laser Cutter | Universal Laser Systems | ILS12.75 | |
Lissamine Rhodamine DOPE | Avanti | 810150 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt) |
Methanol | Finar Chemicals | 30932LL025 | |
Microscope | Olympus | IX81 | |
Phosphate Buffer Saline (PBS) | 1X | ||
Plasma Cleaner | Harrick Plasma Inc | PDC-002 | |
POPC | Avanti | 850457 | 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine |
Programmable Syringe Pump | New Era Pump Systems | NE1010 | High Pressure Syringe Pump |
PTFE Caps | Sigma | 27141 | |
PTFE Tubing | Cole-Parmer | WW-06417-21 | Masterflex, 0.022" ID x 0.042" OD |
Sulphuric Acid | SD Fine Chemicals | 98%, AR Grade | |
TIRF Objective | Olympus | UPLAPO100XOHR | |
Vacuum Desiccator | Tarsons | ||
Vortex Mixer | Tarsons |