JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Résultats
Discussion
Divulgations
Acknowledgements
Materials
References
Please note that all translations are automatically generated. Click here for the English version.
Biochimie

Single-Molecule Diffusie en assemblage op polymeer-crowded lipide membranen

Published: July 19, 2022
doi:
10.3791/64243
, , , , ,
1Department of Chemical Engineering,Indian Institute of Science, 2Holonyak Micro & Nanotechnology Lab,University of Illinois, Urbana-Champaign, 3Center for BioSystems Science and Engineering,Indian Institute of Science

Summary

Hier wordt een protocol gepresenteerd om de binding, mobiliteit en assemblage van afzonderlijke moleculen op kunstmatige overvolle lipidemembranen uit te voeren en te analyseren met behulp van single-molecule total internal reflection fluorescence (smTIRF) microscopie.

Abstract

Cellulaire membranen zijn zeer drukke omgevingen voor biomoleculaire reacties en signalering. Toch gebruiken de meeste in vitro experimenten die de eiwitinteractie met lipiden onderzoeken naakte dubbellaagse membranen. Dergelijke systemen missen de complexiteit van verdringing door membraan-ingebedde eiwitten en glycanen en sluiten de bijbehorende volume-effecten uit die worden aangetroffen op cellulaire membraanoppervlakken. Ook voorkomt het negatief geladen glasoppervlak waarop de lipide bilayers worden gevormd de vrije diffusie van transmembraanbiomoleculen. Hier presenteren we een goed gekarakteriseerd polymeer-lipidemembraan als een nabootsing voor drukke lipidemembranen. Dit protocol maakt gebruik van polyethyleenglycol (PEG) -geconjugeerde lipiden als een gegeneraliseerde benadering voor het opnemen van crowders in de ondersteunde lipide bilayer (SLB). Eerst wordt een reinigingsprocedure van de microscopische dia’s en coverslips gepresenteerd voor het uitvoeren van experimenten met één molecuul. Vervolgens worden methoden besproken voor het karakteriseren van de PEG-SLBs en het uitvoeren van experimenten met één molecuul van de binding, diffusie en assemblage van biomoleculen met behulp van single-molecule tracking en fotobleaching. Ten slotte laat dit protocol zien hoe de nanoporiënassemblage van bacterieel porievormend toxine Cytolysine A (ClyA) op overvolle lipidemembranen kan worden gevolgd met fotobleachingsanalyse met één molecuul. MATLAB-codes met voorbeeldgegevenssets zijn ook opgenomen om enkele van de gemeenschappelijke analyses uit te voeren, zoals het volgen van deeltjes, het extraheren van diffusief gedrag en het tellen van subeenheden.

Introduction

Celmembranen zijn zeer drukke en complexe systemen1. Moleculaire verdringing kan een aanzienlijke impact hebben op de diffusie van membraangebonden entiteiten zoals eiwitten en lipiden 2,3,4. Evenzo worden bimoleculaire reacties op lipidembranen zoals receptordimerisatie of de oligomerisatie van membraancomplexen beïnvloed door verdringing 5,6,7. De aard, configuratie en concentratie van crowders kunnen de membraanbinding, diffusiviteit en eiwit-eiwitinteractie op verschillende manieren regelen 8,9. Omdat het beheersen van membraanverdringing op cellulaire membranen en het interpreteren van de invloed ervan op ingebedde biomoleculen een uitdaging is, hebben onderzoekers geprobeerd alternatieve in vitro systemen op te zetten10.

Een populaire benadering voor kunstmatige overvolle membranen is het dopen van de dubbellaagse membranen met polymeer (zoals polyethyleenglycol, PEG)-getransplanteerde lipiden11,12. Tijdens de visualisatie van eiwit- en lipidedynamiek op ondersteunde lipide bilayers (SLB’s), beschermen deze polymeren bovendien de in het membraan ingebedde componenten van het onderliggende negatief geladen substraat (zoals glas) door de bilayer effectief weg te tillen van de onderliggende ondersteuning. Door de grootte en concentratie van het polymeer te variëren, kan men de mate van moleculaire verdringing regelen, evenals de scheiding van de onderliggende vaste steun13,14. Dit is duidelijk een voordeel ten opzichte van lipide bilayers ondersteund op vaste substraten zonder polymeerkussens 15,16, waar transmembraanbiomoleculen hun activiteit kunnen verliezen 17,18,19. Wat nog belangrijker is, het stelt ons in staat om de drukke omgeving van het celmembraan in vitro samen te vatten, wat van cruciaal belang is voor veel membraanprocessen.

Oppervlakte-geënte polymeren op membranen ondergaan ook veranderingen in hun configuratie, afhankelijk van hun entdichtheid12. Bij lage concentraties blijven ze in een entropisch opgerolde configuratie, bekend als een paddenstoel, boven het membraanoppervlak. Met toenemende concentratie beginnen ze te interageren en hebben ze de neiging om zich los te maken en uit te breiden, wat uiteindelijk een dichte borstelachtige formatie op het membraan oplevert21. Omdat de overgang van de paddenstoel naar het borstelregime zeer heterogeen is en zich manifesteert in slecht gekarakteriseerde omstandigheden van het polymeer, is het belangrijk om goed gekarakteriseerde omstandigheden te gebruiken voor verdringing op polymeergeënte membranen. Vergeleken met een recente studie20, identificeren en rapporteren we drukke membraansamenstellingen die het diffusieve transport en de activiteit van transmembraanbiomoleculen handhaven.

In dit protocol bespreken we hoe we PEGylated lipidemembranen kunnen genereren en geven we aanbevelingen voor PEG-dichtheden die verdringing nabootsen in twee verschillende regimes van polymeerconfiguratie (namelijk paddenstoel en borstel). Het protocol beschrijft ook single-molecule binding, particle tracking en photobleaching data-acquisitie en -analyse voor moleculen ingebed in deze overvolle membranen. Eerst beschrijven we de grondige reinigingsstappen, de assemblage van de beeldkamer en de generatie PEG-SB’s. Ten tweede geven we details voor de single-molecule binding, deeltjes tracking en fotobleaching experimenten. Ten derde bespreken we i) het extraheren van de relatieve bindingsaffiniteiten, ii) het karakteriseren van moleculaire diffusie en iii) het tellen van subeenheden in een eiwitassemblage uit films van afzonderlijke moleculen op het membraan.

Hoewel we dit systeem hebben gekarakteriseerd met beeldvorming met één molecuul, is het protocol nuttig voor alle membraanbiofysici die geïnteresseerd zijn in het begrijpen van het effect van drukte op biomoleculaire reacties op lipidembranen. Over het algemeen presenteren we een robuuste pijplijn voor het maken van drukke en ondersteunde lipide bilayers, samen met verschillende single-molecule assays die op hen zijn uitgevoerd en de bijbehorende analyseroutines.

Protocol

1. Reiniging van de dia en coverslip voor experimenten met één molecuul Maak vóór de montage van de beeldkamer zowel de coverslips als de dia’s schoon en bereid ze voor. Boor meerdere paar gaten op de glasglijbanen met behulp van een boormachine met diamantgecoate boren (0,5-1 mm in diameter). Als acrylplaten worden gebruikt, gebruik dan een lasersnijder om precieze gaten (0,5 mm) te maken, zoals weergegeven in figuur 1.OPMERKING: Elk paar gaten zal fungere…

Representative Results

Monitoring van de binding van ClyA-eiwit op PEGylated membranenNa stap 4.5 wordt de bindingskinetiek geschat door het aantal deeltjes dat in de loop van de tijd aan het membraanoppervlak bindt uit te zetten (video 1). Naarmate ClyA-eiwit zich bindt aan een membraan met 5 mol% PEG2000-lipiden, neemt de deeltjesdichtheid toe en bereikt verzadiging (figuur 5). Een exponentieel verval dat past bij de gebonden deeltjes (cyaancirkels) geeft de tijdconstante (?…

Discussion

Hier demonstreren we experimenten met één molecuul op ondersteunde lipide bilayers (SLB’s) die een drukke omgeving manifesteren voor membraan-ingebedde biomoleculen. De drukke omgeving genereert een uitgesloten volume-effect, wat leidt tot de versterking van biomoleculaire reacties 1,2,39,40. Voor het PEG-lipidensysteem, waarbij het polymeer voornamelijk het volume buiten de dubbellaag inneem…

Divulgations

The authors have nothing to disclose.

Acknowledgements

De auteurs erkennen prof. Benjamin Schuler voor het delen van de uitdrukking plasmide voor ClyA-eiwit. Dit werk werd ondersteund door human frontier science program (RGP0047-2020).

Materials

2.5 ml Syringes HMD Healthcare Dispo Van, 2.5 ml Tuberculin Plastic syringe
Acetone Finar Chemicals 10020LL025
Acrylic Sheet 2 mm thick
Acrylic Sheet BigiMall 2 mm, Clear
Bath Sonicator Branson CPX-1800
Calcium Chloride
Chloroform Sigma 528730  HPLC grade
Cholesterol Avanti 700100
Coplin Jar Duran Wheaton Kimble S6016 8 Slide Jar with Glass Cover
Coverslips VWR 631-1574 24 mm X 50 mm
Cy3-DNA Strand IDT GCTGCTATTGCGTCCGTTTGGTT
GGTGTGGTTGG-Cy3
Cyanine Dye (Cy3) Cytiva Life Sciences PA23001
DiI Invitrogen D3911 Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3)))
DNA Connector Strand 1 Sigma Aldrich GCTGCTATTGCGTCCGTTTAGCT
GGGGGAGTATTGCGGAGGAAGC
T
DNA Connector Strand 2 Sigma Aldrich CGGACGCAATAGCAGCTCACAG
TCGGTCACAT
DNA Tocopherol Strand Biomers Toco-CCCAATGTGACCGACTGTGA
DOPE-PEG2000 Avanti 880130 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt)
Double Sided Tape 3M LF93010LE
Drill Bits (Diamond Coated) 0.5 – 1 mm
Drilling Machine Dremel 220 Workstation
EMCCD Andor DU-897U-CS0-#BV
Fluorescence Beads Invitrogen F10720
Glass Slides Blue Star Micro Slides, PIC-1
Glass Vials Sigma 854190
Hydrogen Peroxide Lobachemie 00182 30% Solution, AR Grade
Labolene Thermo-Fischer Scientific  Detergent
Laser 532 nm Coherent Sapphire
Laser Cutter Universal Laser Systems ILS12.75
Lissamine Rhodamine DOPE Avanti 810150 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt)
Methanol Finar Chemicals 30932LL025
Microscope Olympus IX81
Phosphate Buffer Saline (PBS) 1X
Plasma Cleaner Harrick Plasma Inc PDC-002
POPC Avanti 850457 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine
Programmable Syringe Pump New Era Pump Systems NE1010 High Pressure Syringe Pump
PTFE Caps Sigma 27141
PTFE Tubing Cole-Parmer WW-06417-21 Masterflex, 0.022" ID x 0.042" OD
Sulphuric Acid SD Fine Chemicals 98%, AR Grade
TIRF Objective Olympus UPLAPO100XOHR
Vacuum Desiccator Tarsons
Vortex Mixer Tarsons
DOWNLOAD MATERIALS LIST

References

  1. Löwe, M., Kalacheva, M., Boersma, A. J., Kedrov, A. The more the merrier: Effects of macromolecular crowding on the structure and dynamics of biological membranes. The FEBS Journal. 287 (23), 5039-5067 (2020).
  2. Kuznetsova, I. M., Turoverov, K. K., Uversky, V. N. What macromolecular crowding can do to a protein. International Journal of Molecular Sciences. 15 (12), 23090-23140 (2014).
  3. Horton, M. R., Höfling, F., Rädler, J. O., Franosch, T. Development of anomalous diffusion among crowding proteins. Soft Matter. 6 (12), 2648-2656 (2010).
  4. Jeon, J. H., Javanainen, M., Martinez-Seara, H., Metzler, R., Vattulainen, I. Protein crowding in lipid bilayers gives rise to non-Gaussian anomalous lateral diffusion of phospholipids and proteins. Physical Review X. 6 (2), 021006 (2016).
  5. Zhang, Y., et al. The influence of molecular reach and diffusivity on the efficacy of membrane-confined reactions. Biophysical Journal. 117 (7), 1189-1201 (2019).
  6. Loverdo, C., Bénichou, O., Moreau, M., Voituriez, R. Enhanced reaction kinetics in biological cells. Nature Physics. 4 (2), 134-137 (2008).
  7. Monine, M. I., Haugh, J. M. Reactions on cell membranes: Comparison of continuum theory and Brownian dynamics simulations. Journal of Chemical Physics. 123 (7), 074908 (2005).
  8. Berry, H. Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes. Physical Review E. 89 (2), 22708 (2014).
  9. Saxton, M. J. Anomalous diffusion due to obstacles: A Monte Carlo study. Biophysical Journal. 66 (2), 394-401 (1994).
  10. Andersson, J., Fuller, M. A., Wood, K., Holt, S. A., Köper, I. A tethered bilayer lipid membrane that mimics microbial membranes. Physical Chemistry Chemical Physics. 20 (18), 12958-12969 (2018).
  11. Kaufmann, S., Papastavrou, G., Kumar, K., Textor, M., Reimhult, E. A detailed investigation of the formation kinetics and layer structure of poly(ethylene glycol) tether supported lipid bilayers. Soft Matter. 5 (14), 2804-2814 (2009).
  12. Marsh, D., Bartucci, R., Sportelli, L. Lipid membranes with grafted polymers: Physicochemical aspects. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1615 (1-2), 33-59 (2003).
  13. Labouta, H. I., et al. Surface-grafted polyethylene glycol conformation impacts the transport of PEG-functionalized liposomes through a tumour extracellular matrix model. RSC Advances. 8 (14), 7697-7708 (2018).
  14. Lee, H., Larson, R. G. Adsorption of plasma proteins onto PEGylated lipid bilayers: The effect of PEG size and grafting density. Biomacromolecules. 17 (5), 1757-1765 (2016).
  15. Richter, R. P., Bérat, R., Brisson, A. R. Formation of solid-supported lipid bilayers: An integrated view. Langmuir. 22 (8), 3497-3505 (2006).
  16. Andersson, J., et al. Solid-supported lipid bilayers – A versatile tool for the structural and functional characterization of membrane proteins. Methods. 180, 56-68 (2020).
  17. Duncan, A. L., et al. Protein crowding and lipid complexity influence the nanoscale dynamic organization of ion channels in cell membranes. Scientific Reports. 7 (1), 1-15 (2017).
  18. Garenne, D., Libchaber, A., Noireaux, V. Membrane molecular crowding enhances MreB polymerization to shape synthetic cells from spheres to rods. Proceedings of the National Academy of Sciences of the United States of America. 117 (4), 1902-1909 (2020).
  19. Pollock, N. L., Lee, S. C., Patel, J. H., Gulamhussein, A. A., Rothnie, A. J. Structure and function of membrane proteins encapsulated in a polymer-bound lipid bilayer. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1860 (4), 809-817 (2018).
  20. Coker, H. L. E., et al. Controlling anomalous diffusion in lipid membranes. Biophysical Journal. 116 (6), 1085-1094 (2019).
  21. Rex, S., Zuckermann, M. J., Lafleur, M., Silvius, J. R. Experimental and Monte Carlo simulation studies of the thermodynamics of polyethyleneglycol chains grafted to lipid bilayers. Biophysical Journal. 75 (6), 2900-2914 (1998).
  22. Hallett, F. R., Watton, J., Krygsman, P. Vesicle sizing number distributions by dynamic light scattering. Biophysical Journal. 59 (2), 357-362 (1991).
  23. Jin, A. J., Huster, D., Gawrisch, K., Nossal, R. Light scattering characterization of extruded lipid vesicles. European Biophysics Journal. 28 (3), 187-199 (1999).
  24. Axelrod, D. Chapter 7: Total internal reflection fluorescence microscopy. Methods in Cell Biology. 89, 169-221 (2008).
  25. Fish, K. N. Total internal reflection fluorescence (TIRF) microscopy. Current Protocols in Cytometry. 50 (1), 1-13 (2009).
  26. Fiolka, R., Belyaev, Y., Ewers, H., Stemmer, A. Even illumination in total internal reflection fluorescence microscopy using laser light. Microscopy Research and Technique. 71 (1), 45-50 (2008).
  27. Roy, R., Hohng, S., Ha, T. A practical guide to single-molecule FRET. Nature Methods. 5 (6), 507-516 (2008).
  28. Jaqaman, K., et al. Robust single-particle tracking in live-cell time-lapse sequences. Nature Methods. 5 (8), 695-702 (2008).
  29. Tinevez, J. Y., et al. TrackMate: An open and extensible platform for single-particle tracking. Methods. 115, 80-90 (2017).
  30. Jarmoskaite, I., Alsadhan, I., Vaidyanathan, P. P., Herschlag, D. How to measure and evaluate binding affinities. eLife. 9, 57264 (2020).
  31. Sathyanarayana, P., et al. Cholesterol promotes Cytolysin A activity by stabilizing the intermediates during pore formation. Proceedings of the National Academy of Sciences of the United States of America. 115 (31), 7323-7330 (2018).
  32. Mueller, M., Grauschopf, U., Maier, T., Glockshuber, R., Ban, N. The structure of a cytolytic alpha-helical toxin pore reveals its assembly mechanism. Nature. 459 (7247), 726-730 (2009).
  33. Hubicka, K., Janczura, J. Time-dependent classification of protein diffusion types: A statistical detection of mean-squared-displacement exponent transitions. Physical Review E. 101 (2), 1-13 (2020).
  34. Kepten, E., Weron, A., Sikora, G., Burnecki, K., Garini, Y. Guidelines for the fitting of anomalous diffusion mean square displacement graphs from single particle tracking experiments. PLoS ONE. 10 (2), 0117722 (2015).
  35. Persson, F., Lindén, M., Unoson, C., Elf, J. Extracting intracellular diffusive states and transition rates from single-molecule tracking data. Nature Methods. 10 (3), 265-269 (2013).
  36. McGuire, H., Aurousseau, M. R. P., Bowie, D., Blunck, R. Automating single subunit counting of membrane proteins in mammalian cells. The Journal of Biological Chemistry. 287 (43), 35912-35921 (2012).
  37. Hines, K. E. Inferring subunit stoichiometry from single molecule photobleaching. The Journal of General Physiology. 141 (6), 737-746 (2013).
  38. Zhang, H., Guo, P. Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation. Methods. 67 (2), 169-176 (2014).
  39. Phillip, Y., Schreiber, G. Formation of protein complexes in crowded environments-From in vitro to in vivo. FEBS Letters. 587 (8), 1046-1052 (2013).
  40. Mittal, S., Chowhan, R. K., Singh, L. R. Macromolecular crowding: Macromolecules friend or foe. Biochimica et Biophysica Acta – General Subjects. 1850 (9), 1822-1831 (2015).
  41. Mashaghi, S., van Oijen, A. M. A versatile approach to the generation of fluid supported lipid bilayers and its applications. Biotechnology and Bioengineering. 111 (10), 2076-2081 (2014).
  42. Wong, W. C., et al. Characterization of single-protein dynamics in polymer-cushioned lipid bilayers derived from cell plasma membranes. The Journal of Physical Chemistry B. 123 (30), 6492-6504 (2019).
  43. Shashkova, S. S., Leake, M. C. Single-molecule fluorescence microscopy review: Shedding new light on old problems. Bioscience Reports. 37 (4), 20170031 (2017).
  44. Ishikawa-Ankerhold, H. C., Ankerhold, R., Drummen, G. P. C. Advanced fluorescence microscopy techniques-FRAP, FLIP, FLAP, FRET and FLIM. Molecules. 17 (4), 4047 (2012).
  45. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  46. Carter, B. C., Vershinin, M., Gross, S. P. A comparison of step-detection methods: How well can you do. Biophysical Journal. 94 (1), 306-319 (2008).
  47. Otsuka, S., Ellenberg, J. Mechanisms of nuclear pore complex assembly – Two different ways of building one molecular machine. FEBS Letters. 592 (4), 475 (2018).
  48. Tsekouras, K., Custer, T. C., Jashnsaz, H., Walter, N. G., Pressé, S. A novel method to accurately locate and count large numbers of steps by photobleaching. Molecular Biology of the Cell. 27 (22), 3601-3615 (2016).
  49. Bryan, J. S., Sgouralis, I., Pressé, S. Enumerating high numbers of fluorophores from photobleaching experiments: A Bayesian nonparametrics approach. bioRxiv. , (2020).
  50. Bryan, J. S., Sgouralis, I., Pressé, S. Diffraction-limited molecular cluster quantification with Bayesian nonparametrics. Nature Computational Science. 2 (2), 102-111 (2022).
  51. Kim, Y., et al. Efficient site-specific labeling of proteins via cysteines. Bioconjugate Chemistry. 19 (3), 786-791 (2008).

Tags

Single-molecule ImagingPolymer-crowded Lipid MembranesSupported Lipid BilayersMembrane Biomolecular ReactionsDiffusionAssemblyPOPCDOPE-PEG(2000)Small Unilamellar VesiclesSonicationMicrofluidic Imaging Chambers

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citer Cet Article
Maurya, S., Rai, V. H., Upasani, A., Umrao, S., Parwana, D., Roy, R. Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes. J. Vis. Exp. (185), e64243, doi:10.3791/64243 (2022).
Télécharger la Citation
Réimpressions et Autorisations

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image