1. Generation of iPSC Aggregates
2. Induction of Anterior Neuroectoderm
3. Embedding of Neuroectodermal Aggregates in a Matrix Scaffold
4. Generation of Forebrain-type Organoids from Neuroectodermal Aggregates
5. Fixation and Validation of Forebrain-type Organoids
The standardized forebrain-type organoid protocol described here typically generates highly homogenous organoid cultures of almost exclusively dorsal cortical identity from human iPSCs within 20 days of cultivation (protocol outlined in Figure 1A). It is recommended to perform several quality control steps during the time course of the protocol, defined here as: 'go' (continue the differentiation process) and 'no-go' (suboptimal cultures, it is recommended to terminate the batch) (Figure 1). It is also advisable to document each quality control step well by taking images and notes.
The first critical step in generating forebrain-type organoids is to start with high-quality iPSC cultures. It is important that iPSCs do not contain larger fractions of differentiated cells. Only use iPSC cultures that present as a homogeneous monolayer of undifferentiated cells at the starting population (Figures 1B, C). In addition, it is crucial to start with the given cell number for iPSC aggregation. The first detailed inspection of the iPSC aggregates should be performed on day 2. At this stage, the aggregates should have formed compact cell buds with smooth edges ('go') whereas irregular appearing aggregates or aggregates with cavities should be discarded ('no-go') (Figures 1D, E). The next quality control step should be performed at day 10 of the protocol. At this time point, the cell aggregates should show smooth and optically translucent tissue on the outer surface representing induction of neuroectoderm ('go') whereas the absence of such tissue indicates suboptimal neural induction ('no-go') (Figures 1F, G). Only those aggregates that exhibit a translucent surface (Figure 1F) should be embedded into BME matrix. Once embedded, the cortical organoids will develop continuous neuroepithelial loop-like structures, which will expand quickly. Analyze the efficiency of the cortical induction at day 15 and day 20 by investigating whether the organoids have developed polarized neural ectoderm as demonstrated in Figure 1H, J ('go'). In the case that organoids have not developed such neuroepithelial buds ('no-go' as illustrated in Figure 1I, K), critically revise the performed quality control steps for troubleshooting. When tightly following the protocol, highly standardized organoid batches will be generated (Figures 2A, B), which will show ≥ 90% homogeneity in polarized neural ectoderm formation within and across batches (Figure 2C). A common mistake leading to variable efficiency of polarized neural ectoderm formation is to increase the starting cell number for iPSC aggregation, or to start with low-quality iPSC cultures such as mycoplasma contaminated cultures or cultures that contain differentiated cells.
A detailed validation of the dorsal telencephalic identity of the generated organoids should be performed at day 20. To that end, 3 organoids should be fixed and used for immunofluorescence analyses. Stratified neuroepithelial loops (Figure 3A) express the neural stem cell marker Sox2 (Figure 3B, D), the forebrain markers Pax6 and Otx2 (Figures 3C, E), and the dorsal cortical marker Emx1 (Figure 3F). These cortical loops are further characterized by an apical localization of N-cadherin and ZO-1 (Figures 3G, H), ventricular zone radial glia cell (vRGC)-derived microtubule, which spans from the apical to the basal side of the structures (Figure 3I), and apical located dividing cells that stain positive for phosphorylated vimentin (p-Vimentin, Figure 3J). Cell death might be present inside the organoid structures. Central apoptosis is normal and does not affect the development of cortical tissue. Additionally, 3 organoids should be used to assess the homogeneity of the protocol by gene expression analyses. Forebrain-type organoids show expression of the dorsal forebrain markers (FoxG1, Otx2, Emx1), while expression of the midbrain (FoxA2, Pax5) and the hindbrain (HoxB2, HoxA4, HoxB4, HoxB6) markers is not detectable (Figure 3K).
Batches of quality-controlled organoids can be used for various applications like the analyses of the division plane of apical radial glial cells. To that end, we suggest performing double staining using antibodies against p-Vimentin and Tpx2 (Figure 3J). P-Vimentin is phosphorylated by CDK1 during mitosis and is located in the nucleus, thus marking all nuclei in the mitotic phase16. Tpx2 is a microtubule associated protein that can visualize the mitotic spindle and the apical processes during interkinetic nuclear migration17,18. Using these markers, three aspects of vRGC division can in principle be analyzed: (I) whether cell division takes place at the apical side, (II) whether the division plane is aligned vertical (indicating symmetric cell division), horizontal, or oblique (indicating asymmetric cell division) to the apical surface, and (III) whether microtubule organizing centers are formed normally.
Organoids can be also further differentiated into more complex organized and stratified cortical tissue structures. Cortical structures within day 35 ± 2 organoids are composed of a ventricular zone (VZ)-, an inner and outer subventricular zone (SVZ), as well as a cortical plate (CP)-like area. Within the VZ and the inner and outer SVZ, vRGCs, intermediate progenitors (IPs), and cells reminiscent of oRGCs can be identified. In addition, the initial formation of a layered cortex can be observed in the CP-like area with deep cortical neurons expressing Tbr1 and Ctip2 inside and upper cortical neurons expressing Satb2, as well as Reelin-expressing cells in the outer regions10.
Figure 1: Schematic overview of the organoid protocol and illustration of 'go' and 'no-go' criteria. (A) Schematic overview of the protocol. CI medium: cortical induction medium; CD: cortical differentiation medium. (B–C) Image of an optimal 90% confluent iPSC monolayer culture (B) and a non-suitable iPSC culture exhibiting differentiation (C). (D–E) An iPSC aggregate optimal in size, cell density, and surface appearance (D) and two 'no-go' cell aggregates exhibiting either cell spares cavities (E, upper aggregate) or irregular edges (E, lower aggregate) two days following cell aggregation. (F–G) Cell aggregates exhibiting translucent and smooth edges (F) and cell aggregates lacking optical clearing (G). The yellow line is visualizing the area of interest. (H–K) An optimal organoid with continuous neuroepithelial loops (H, J) and an organoid that failed to develop radially organized neuroectoderm (I, K) imaged at day 15 and day 20, respectively. Scale bars, B-C 500 µm; D-K 200 µm. Please click here to view a larger version of this figure.
Figure 2: Homogeneity and reproducibility of the forebrain-type organoid protocol. (A–B) Representative bright-field images of organoids from one batch at day 15 (A) and day 26 (B). (C) Quantitative analyses of organoids at day 20. Organoids which display at the outer surface a neuroepithelium, recognizable in bright-field as optically clear superficial tissue with a clear border and evidence of radial cellular architecture were quantified (n = 3 per iPSC line with at least 16 organoids per experiment). Scale bars, A-B: 500 µm. Error bars ± SD. Please click here to view a larger version of this figure.
Figure 3: Validation of forebrain-type organoids at day 20. (A–J) Immunocytochemical characterization of organoids. Organoids organize in multiple neuroepithelial loops (A, counterstained with DAPI). Stratified organized cells within the neuroepithelial loops express the neural stem cell marker Sox2 (B, D), the forebrain markers Pax6 (C, D) and Otx2 (E), as well as the dorsal forebrain marker Emx1 (F). Cortical loop structures exhibited a fine adherent junction belt at the most apical side with the accumulation of N-cadherin (G) and zona occludens protein 1 (ZO-1; H). Ventricular RGCs' microtubule networks (stained by acetylated α-tubulin, Ac-Tub) extend from the apical to the basal side of the loop structures (I). Proliferating cells expressing p-vimentin (p-Vim) are located at the apical surface. Mitotic spindles are stained by Tpx2. Representative higher magnification image of a vertical and a horizontal division plane are shown on the right (J). (K) RT-PCR analysis for the region-specific transcription factors at day 20 of two independent sets of organoids derived from 2 different iPSC lines. FB: fetal brain control; AB: adult brain control. Scale bars, A-D 200 µm; E-I 10 µm. Please click here to view a larger version of this figure.
Epitope | Dilution |
Sox2 | 1 – 300 |
Pax6 | 1 – 500 |
Otx2 | 1 – 500 |
Emx1 | 1 – 50 |
N-cadherin | 1 – 500 |
ZO-1 | 1 – 100 |
P-Vimentin | 1 – 1000 |
Tpx2 | 1 – 500 |
Acetylated α-tubulin | 1 – 500 |
Alexa488 anti ms | 1 – 1000 |
Alexa488 anti rb | 1 – 1000 |
Alexa555 anti ms | 1 – 1000 |
Alexa555 anti rb | 1 – 1000 |
Table 1: Antibodies for quality control of organoids at day 20.
Primer | Sequence |
Otx2 forward | tgcaggggttcttctgtgat |
Otx2 reverse | agggtcagagcaattgacca |
FoxG1 forward | ccctcccatttctgtacgttt |
FoxG1 reverse | ctggcggctcttagagat |
Emx1 forward | agacgcaggtgaaggtgtgg |
Emx1 reverse | caggcaggcaggctctcc |
FoxA2 forward | ccaccaccaaccccacaaaatg |
FoxA2 reverse | tgcaacaccgtctccccaaagt |
Pax5 forward | aggatgccgctgatggagtac |
Pax5 reverse | tggaggagtgaatcagcttgg |
HoxB2 forward | tttagccgttcgcttagagg |
HoxB2 reverse | cggatagctggagacaggag |
HoxA4 forward | ttcagcaaaatgccctctct |
HoxA4 reverse | taggccagctccacagttct |
HoxB4 forward | acacccgctaacaaatgagg |
HoxB4 reverse | gcacgaaagatgagggagag |
HoxB6 forward | gaactgaggagcggactcac |
HoxB6 reverse | ctgggatcagggagtcttca |
18s forward | ttccttggaccggcgcaag |
18s reverse | gccgcatcgccggtcgg |
Table 2: Primer and primer sequences for gene expression profile.
A83-01 | StemGent | 130-106-274 | 500 nM |
B27 Supplement | Gibco | 17504-044 | 1 to 100 |
Basement membrane extract (e.g. Geltrex) | Gibco | A14132-02 | |
Cyclic adenosine monophosphate (cAMP) | Sigma-Aldrich | A9501 | 0.15 µg/mL |
Cell-dissociation reagent (TrypLE Express) | Gibco | 12605028 | |
Counting chamber e.g. Fuchs-Rosenthal | Karl Hecht | 40449001 | |
D-Glucose | Carl Roth | HN06.3 | 0.2 mg/mL |
DMEM-F12 L-Glutamin | Gibco | 11320033 | |
Embedding molds (Tissue-Tek Cryomold) | Sakura Finetek | 4565 | |
Ethylenediaminetetraacetic acid | Sigma-Aldrich | E6511 | 0.5 mM |
Gelantin | Sigma-Aldrich | G1890 | |
Heparin | Sigma-Aldrich | H3149-25KU | 10 ug/mL |
Inhibitor of WNT response (IWR-1) | Enzo Life Science | BML-WN103-0005 | 10 ug/mL |
Insulin | Sigma-Aldrich | 91077C | 2.5 µg/mL |
IPSC medium for monolayer cultures (Pluripro) | Cell Guidance Systems | MK01 | |
L-alanyl-L-glutamine (GlutaMax) | Gibco | 35050038 | 1% |
Low-adhesion 6 cm plates | Labomedic | 2081646L | |
Low-adhesion 10 cm plates | Labomedic | 2081646O | |
LDN-193189 | Miltenyi Biotec | 130-104-171 | 180 nM |
N2 Supplement | Gibco | 17502-048 | 1 to 200 |
Non-essential amino acids | Gibco | 11140035 | 0.50% |
Paraformaldehyde | Sigma-Aldrich | P6148 | 4.00% |
Phosphate buffered saline (PBS) | Gibco | 14190144 | |
Plastic paraffin film (Parafilm) | BRAND GMBH + CO KG | 701606 | |
ROCK inhibitor Y-27632 | Cell Guidance Systems | SM02-100 | 5 µM or 50 µM |
Sucrose | Sigma-Aldrich | S7903 | |
Tubes 15 mL | Corning Life Sciences | 734-0451 | |
Microscope Slides e.g. Superfrost Plus Microscope Slides | Thermo Scientific | 4951PLUS4 | |
Tissue culture 6 well plate | Falcon | 734-0019 | |
Tissue culture 24 well plate | Falcon | 734-0949 | |
Trypan blue stain | Gibco | 15250-061 | |
Ultra-low-binding 96 well lipidure-coat plate A-U96 | Amsbio | AMS.51011610 | |
Antibodies | |||
Sox2 | R&D Systems | MAB2018 | |
Pax6 | Covance | PRB-278P-100 | |
Otx2 | R&D Systems | ab9566 | |
Emx1 | Sigma | HPA006421 | |
N-cadherin | BD | 610921 | |
ZO-1 | Life Tech | 61-7300 | |
P-Vimentin | Biozol | D076-3 | |
Tpx2 | Novus Biologicals | NB500-179 | |
Acetylated α-tubulin | NEB/CS | 5335 | |
Alexa488 anti ms | Invitrogen | A11001 | |
Alexa488 anti rb | Invitrogen | A11008 | |
Alexa555 anti ms | Invitrogen | A21424 | |
Alexa555 anti rb | Invitrogen | A21429 |
The human cortex is highly expanded and exhibits a complex structure with specific functional areas, providing higher brain function, such as cognition. Efforts to study human cerebral cortex development have been limited by the availability of model systems. Translating results from rodent studies to the human system is restricted by species differences and studies on human primary tissues are hampered by a lack of tissue availability as well as ethical concerns. Recent development in human pluripotent stem cell (PSC) technology include the generation of three-dimensional (3D) self-organizing organotypic culture systems, which mimic to a certain extent human-specific brain development in vitro. Currently, various protocols are available for the generation of either whole brain or brain-region specific organoids. The method for the generation of homogeneous and reproducible forebrain-type organoids from induced PSC (iPSC), which we previously established and describe here, combines the intrinsic ability of PSC to self-organize with guided differentiation towards the anterior neuroectodermal lineage and matrix embedding to support the formation of a continuous neuroepithelium. More specifically, this protocol involves: (1) the generation of iPSC aggregates, including the conversion of iPSC colonies to a confluent monolayer culture; (2) the induction of anterior neuroectoderm; (3) the embedding of neuroectodermal aggregates in a matrix scaffold; (4) the generation of forebrain-type organoids from neuroectodermal aggregates; and (5) the fixation and validation of forebrain-type organoids. As such, this protocol provides an easily applicable system for the generation of standardized and reproducible iPSC-derived cortical tissue structures in vitro.
The human cortex is highly expanded and exhibits a complex structure with specific functional areas, providing higher brain function, such as cognition. Efforts to study human cerebral cortex development have been limited by the availability of model systems. Translating results from rodent studies to the human system is restricted by species differences and studies on human primary tissues are hampered by a lack of tissue availability as well as ethical concerns. Recent development in human pluripotent stem cell (PSC) technology include the generation of three-dimensional (3D) self-organizing organotypic culture systems, which mimic to a certain extent human-specific brain development in vitro. Currently, various protocols are available for the generation of either whole brain or brain-region specific organoids. The method for the generation of homogeneous and reproducible forebrain-type organoids from induced PSC (iPSC), which we previously established and describe here, combines the intrinsic ability of PSC to self-organize with guided differentiation towards the anterior neuroectodermal lineage and matrix embedding to support the formation of a continuous neuroepithelium. More specifically, this protocol involves: (1) the generation of iPSC aggregates, including the conversion of iPSC colonies to a confluent monolayer culture; (2) the induction of anterior neuroectoderm; (3) the embedding of neuroectodermal aggregates in a matrix scaffold; (4) the generation of forebrain-type organoids from neuroectodermal aggregates; and (5) the fixation and validation of forebrain-type organoids. As such, this protocol provides an easily applicable system for the generation of standardized and reproducible iPSC-derived cortical tissue structures in vitro.
The human cortex is highly expanded and exhibits a complex structure with specific functional areas, providing higher brain function, such as cognition. Efforts to study human cerebral cortex development have been limited by the availability of model systems. Translating results from rodent studies to the human system is restricted by species differences and studies on human primary tissues are hampered by a lack of tissue availability as well as ethical concerns. Recent development in human pluripotent stem cell (PSC) technology include the generation of three-dimensional (3D) self-organizing organotypic culture systems, which mimic to a certain extent human-specific brain development in vitro. Currently, various protocols are available for the generation of either whole brain or brain-region specific organoids. The method for the generation of homogeneous and reproducible forebrain-type organoids from induced PSC (iPSC), which we previously established and describe here, combines the intrinsic ability of PSC to self-organize with guided differentiation towards the anterior neuroectodermal lineage and matrix embedding to support the formation of a continuous neuroepithelium. More specifically, this protocol involves: (1) the generation of iPSC aggregates, including the conversion of iPSC colonies to a confluent monolayer culture; (2) the induction of anterior neuroectoderm; (3) the embedding of neuroectodermal aggregates in a matrix scaffold; (4) the generation of forebrain-type organoids from neuroectodermal aggregates; and (5) the fixation and validation of forebrain-type organoids. As such, this protocol provides an easily applicable system for the generation of standardized and reproducible iPSC-derived cortical tissue structures in vitro.