מתן יעיל של הפרעת RNA דרך הפה (RNAi) ליתושים אנופלס גמביה בוגרים
Summary
מתן אוראלי של dsRNA המיוצר על ידי חיידקים, שיטת אספקה להפרעות RNA (RNAi) המשמשת באופן שגרתי ב – Caenorhabditis elegans, יושם כאן בהצלחה על יתושים בוגרים. השיטה שלנו מאפשרת מחקרים חזקים בגנטיקה הפוכה ומחקרי וקטורים חוסמי העברה ללא שימוש בהזרקה.
Abstract
הפרעת RNA הייתה כלי בשימוש רב לניתוח גנטי הפוך במשך שני עשורים. אצל יתושים בוגרים, מתן RNA דו-גדילי (dsRNA) הושג בעיקר באמצעות הזרקה, הדורשת זמן משמעותי ואינה מתאימה ליישומי שדה. כדי להתגבר על מגבלות אלה, כאן אנו מציגים שיטה יעילה יותר להפעלה חזקה של RNAi על ידי אספקה דרך הפה של dsRNA לגמביה אנופלס בוגרת. dsRNA ארוכים יוצרו בזן Escherichia coli HT115 (DE3), ותרחיף מרוכז של חיידקים המכילים dsRNA מומתים בחום ב-10% סוכרוז הוצע על כדורי צמר גפן ad-libitum ליתושים בוגרים. כדורי צמר גפן הוחלפו כל יומיים למשך הטיפול. שימוש בשיטה זו כדי להתמקד בדאבלסקס (גן המעורב בהתמיינות בין המינים) או בראש מזלג (המקודד גורם שעתוק של בלוטת הרוק) הביא לביטוי מופחת של גני מטרה ו/או לאות אימונופלואורסצנציה של חלבון, כפי שנמדד על ידי PCR כמותי בזמן אמת (qRT-PCR) או מיקרוסקופיה קונפוקלית פלואורסצנטית, בהתאמה. נצפו גם פגמים במורפולוגיה של בלוטת הרוק. שיטה גמישה מאוד זו, ידידותית למשתמש, בעלות נמוכה וחסכונית בזמן של אספקת dsRNA יכולה להיות ישימה באופן נרחב לגני מטרה החשובים לפיזיולוגיה של וקטור חרקים ומעבר לה.
Introduction
מחלות רבות מועברות על ידי יתושים, מה שהופך את המחקר של פיזיולוגיה יתושים וגנטיקה למשימה חשובה. השימוש ב-RNAi באורגניזמים אלה בלט ב-20 השנים האחרונות ואיפשר אפיון תפקודי של גנים רבים של יתושים 1,2,3,4,5. הטכניקה הנפוצה ביותר להעברת dsRNA הייתה microinjection, אשר יש את החסרונות כי זה יכול לפצוע את היתושים דורש זמן ומאמץ משמעותי. שיטות אספקה דרך הפה עבור RNAi נבדקו, אך בעיקר בשלב הזחל של היתושים 6,7,8,9. אספקה דרך הפה של dsRNA אצל יתושים בוגרים לא נחקרה במלואה ויכולה להיות כלי שימושי לחקר הביולוגיה הווקטורית והבקרה הווקטורית.
מלריה מועברת על ידי יתושי אנופלס כאשר יתוש נקבה נגועה לוקחת ארוחת דם מפונדקאי לא נגוע ומזריקה רוק המכיל טפילי מלריה10. כדי שבסופו של דבר יועבר ברוק של יתוש, הטפיל חייב להתגבר על מכשולים רבים, כולל התחמקות ממערכת החיסון של היתושים, חציית מחסום המידגוט ופלישה לבלוטות הרוק11. ארכיטקטורת בלוטת הרוק של יתושים (SG) היא המפתח לפלישת הטפילים וארכיטקטורה זו נשלטת הן על ידי גורמי שעתוק מרכזיים המבטאים בלוטת הרוק והן על ידי גורמים קובעים של דימורפיזם מיני. מספר גורמי שעתוק שמורים מאוד נדרשים לצורך אפיון תאי ותחזוקה הומאוסטטית של בלוטות הרוק ולייצור והפרשת חלבוני רוק הפועלים בהזנתדם 12,13,14. ראש מזלג (Fkh) הוא גורם שעתוק סליל מכונף המתפקד כרגולטור עיקרי של מבנה ותפקוד SG של חרקים (בהתבסס על מחקרים בזבובי פירות ובעש תולעי המשי)15,16,17,18,19,20. ב-Drosophila SGs, Fkh מתפקד עם Sage, גורם שעתוק סליל-לולאה-סליל בסיסי ספציפי ל-SG (bHLH), כדי לקדם את הישרדות ה-SG ואת ייצור הרוק19. מווסת שותף חשוב וחיובי של ייצור הרוק בדרוזופילה הוא CrebA, גורם שעתוק רוכסן לאוצין שנחקר היטב, אשר מווסת את הביטוי של גנים של מסלול הפרשה 21,22,23. יש גם מידה חזקה של התמיינות מורפולוגית בבלוטות הרוק הנשיות שככל הנראה ממלאת תפקיד מפתח, לא רק בהזנת דם אלא גם ביכולתם של טפילים לפלוש לרקמה זו24.
לרבים מהגנים המעורבים בקביעת הישרדות בלוטת הרוק, המבנה, הפיזיולוגיה והדימורפיזם המיני יש פרופילי ביטוי מרחביים מורכבים 25,26,27, ושיטות המסירה המסורתיות של dsRNA להשראת RNAi אינן תמיד יעילות בהתמקדות בגנים מסוג זה או ברקמות אחרות. עם זאת, אספקה דרך הפה של dsRNA בשלב הזחל Aedes aegypti ו– An. gambiae יתושים שימשה בהצלחה כדי להשתיק את הצורה הספציפית לנקבה של הגן dsx 9,28. מחקרים קודמים שהשתמשו ב-dsRNA בבלוטות הרוק של היתושים מצאו שלמרות שנדרשו כמויות גדולות של dsRNA, אפקט ההשתקה היה ארוך יחסית (לפחות 13 יום)29. כאן נבדקה היכולת של זן E. coli HT115 (DE3) המבטא dsRNA ספציפי לרצף עבור dsx, fkh או CrebA לגרום להשתקת RNAi של גנים אלה אצל יתושים נקבות בוגרות. מתן אוראלי של dsRNA גרם להפלת גנים ב– An. gambiae, עם הפחתה ברורה ברמות mRNA ועם פנוטיפים התואמים את אובדן התפקוד של גנים אלה. לפיכך, סביר להניח שגישה זו תעבוד כדי להפיל את תפקודם של מגוון גנים של בלוטות הרוק.
Protocol
Representative Results
Discussion
ליכולת להעביר ביעילות dsRNA ליתושי An. gambiae על ידי האכלה דרך הפה יש השלכות רחבות על מחקרים על ביולוגיה וקטורית הן במעבדה והן בשטח. Microinjection כבר מזמן מקובל כדרך המועדפת של אספקת כימיקלים, נוגדנים, RNAi, ואסטרטגיות שינוי גנטיות יתושים43,44. ניתן להימנע מהתוצאה של מניפולציה פיזית משמעותית, נזק לתאים ומתח על ידי שימוש בלידה דרך הפה, שעשויה להתאים גם ליישומים בקנה מידה גדול או בשטח. עבודות קודמות הציעו כי RNAi פועל בכל מקום בתוך יתושבוגר בודד 29, ומאפשר השפעות בכל הרקמות, כולל בלוטות הרוק. על ידי האכלת יתושים במספרים גדולים של E. coli המבטאים dsRNA, המתעכלים באופן אסינכרוני לאורך פרק זמן ארוך, ניתן להשיג חשיפה עקבית ואחידה ל-RNAi על פני כל הפרטים בכלוב. שיטה זו מאפשרת להאכיל מספר רב של יתושים ולנתח את השונות הפוטנציאלית של הפנוטיפים המתקבלים בהתאם לגן המטרה. עם זאת, אחד השיקולים החשובים הוא האפשרות של הפצה הטרוגנית של החיידקים, ומכאן dsRNA, בסיבי הכותנה. 400 מיקרול’ של חיידקים המשמשים מדי יום להזנת יתושים מסוכר יכילו כ-≤4.6 מיקרוגרם של dsRNA, כפי שתואר וחושב קודם לכן9, אך כמות ה-dsRNA שנבלעה על ידי כל יתוש לא נקבעה בנפרד. אם בניית מבני dsRNA הופכת לשגרה, פרוטוקול טיפול פשוט זה מאפשר הטמעה מהירה של טכניקה זו על ידי כל חוקר יתושים. א-פריורי, זמן ההוצאה במהלך הטיפול (30 דקות ביום) הוא טריוויאלי בהשוואה לזמן שלוקח ללמוד וליישם מיקרו-איניג’ינג בגדלים דומים של דגימות.
האכלת dsRNA משמשת באופן שגרתי למחקרי גנטיקה הפוכה באורגניזם המודל Caenorhabditis elegans45. רמת שימוש כבדה זו מדגישה את הערך של גישת הלידה האוראלית. בניית ספרייה כלל-גנומית של An. gambiae ב-E. coli שעברה טרנספורמציה, בדומה לזו הקיימת ב-C. elegans46,47, תאפשר בדיקה גנטית הפוכה מהירה אצל יתושים בקנה מידה מוגבר. עם זאת, חשוב לציין כי יעילות השיטה תלויה במידה רבה ברמות האנדוגניות של התעתיק ואם הביטוי אינו מוגבל לרקמת המטרה אלא מבוטא באופן רחב יותר 4,8,44. בנוסף, ישנן עדויות לכך שכמה קוטלי חרקים יכולים לגרום להימנעות התנהגותית מיתושים48, והאכלה בחיידקים שעלולים לגרום להם לתופעות לוואי עלולה לעורר דפוסים דומים של הימנעות. בסביבה המבוקרת של המעבדה, שבה ליתושים לא היה מקור מזון חלופי, לא הייתה להם ברירה להימנע ממי הסוכר עם E. coli והצורך במקור מזין כנראה יגבר על האינסטינקט להימנע מהחיידקים. עם זאת, יש לשקול זאת אם האסטרטגיה נועדה לשמש בהגדרות פחות מבוקרות.
ייתכן שניתן יהיה לכוון למספר גנים בו-זמנית (באמצעות מבנה אחד, מספר מבנים או תערובת של חיידקים מבודדים שעברו טרנספורמציה), אך נדרשים מחקרים נוספים כדי להעריך את היעילות. שיקול חשוב נוסף לנקודה זו הוא הערכה של השפעות אפשריות מחוץ למטרה או סינרגטיות בעת שימוש ביעדים בודדים או מרובים. הקמת גנים וקבוצות בקרה מתאימים היא חלק חשוב בתכנון הניסוי. יתר על כן, מפתה לשער כי גישה זו יכולה לשמש כדי להתמקד בפתוגנים או וירוסים אחרים49. עבודה קודמת לקראת אינדוקציה של RNAi ביתושים בוצעה בתנאים שבהם הריאגנט הוזרק ישירות, ולכן E. coli לא היו נוכחים. ה – E. coli עשוי לספק תא מגן המאפשר שחרור איטי יותר של dsRNA לאורך זמן, ומבטיח שהחשיפה תהיה פחות או יותר רציפה לאורך תקופה ארוכה בהרבה29.
לבסוף, תוצאות אלה מראות כי ההשפעות של טכניקה זו ניתנות לכוונון על ידי התאמת מסגרת הזמן (אורך ויום ההתחלה) של החשיפה והכמות של E. coli בשימוש. תכונה זו אפשרה לנו לחקור את הפונקציות של גנים חיוניים (dsx ו – fkh) על ידי זיהוי תנאי נפילה אופטימליים על ידי ניסוי וטעייה. זה משפר מאוד את הסבירות שניתן לחקור גנים ממוקדים בעלי עניין באמצעות טכניקה זו.
לסיכום, נמצא כי מסירה דרך הפה של RNAi ליתושים בוגרים יכולה להיות פשוטה, רב-תכליתית וגישה רבת עוצמה לחקר תפקוד הגנים של היתושים וליצירת כלים חדשניים ובלתי ניתנים להדברה וקטורית של מחלות המועברות על ידי יתושים.
Disclosures
The authors have nothing to disclose.
Acknowledgements
המחברים מבקשים להודות לצוות ולמדענים בענף האנטומולוגיה ובמחלקה למחלות טפיליות ומלריה ב-CDC, ולבריאן טריג ומישל צ’יו על הסיוע בהכנת חיידקים ב-JHU ו/או על דיונים מועילים בעבודה זו. אנו מודים ל-JHMRI Insectary ולמנהל כריס קיזיטו על הגישה והגידול של יתושי An. gambiae . אנו מודים ל-Wei Huang (JHSPH) על הסיוע בהשגת פלסמידים PJet GFP ו-pPB47 GFP לשימוש במחקר זה. המימון לעבודה זו ניתן על ידי: NIH R21AI153588 (ל- DJA), מלגת פוסט-דוקטורט של מכון ג’ונס הופקינס לחקר המלריה (ל- MW); ועל ידי מענק מקרן Good Ventures ופרויקט הפילנתרופיה הפתוחה לקרן CDC שכותרתה תמיכה בשמירת בהקפאה ודיכוי התפתחות נשית של יתושים כדי לסייע במחקר על מלריה, פרויקט פילנתרופיה פתוחה, 2017. אנו מעריכים מאוד את הסיוע של צוות מתקן המיקרוסקופ JHU ואת התמיכה הרלוונטית במענק NIH עבור המיקרוסקופ שבו נעשה שימוש (מענק NIH #: S10OD016374). הממצאים והמסקנות בכתב יד זה הם של המחברים ואינם מייצגים בהכרח את דעותיו של ה-CDC. השימוש בשמות מסחריים הוא לצורך זיהוי בלבד ואינו מרמז על תמיכה על ידי המרכזים לבקרת מחלות ומניעתן, שירות בריאות הציבור או מחלקת הבריאות ושירותי האנוש של ארה”ב.
Materials
| 1 Kb Plus DNA Ladder | Thermo Fisher Scientific | 10787018 | |
| 2x Yeast Extract Tryptone (2xYT) Medium | BD Difco | DF0440-17 | |
| AAPP | n/a | n/a | Antisera. 1:50 dilution (rabbit); gift from Fabrizio Lombardo |
| AccuStart II PCR Supermix | Quantabio | 95137-100 | |
| Agarose | Millipore Sigma | A9539 | |
| Ampicillin | Millipore Sigma | A5354 | |
| Anopheles gambiae G3 | BioDefense and Emerging Infections (BEI) Malaria Research and Reference Reagent Resource Center (MR4) | MRA-112 | |
| BugDorm | BioQuip | 1452 | |
| Centrifuge 5810R | Eppendorf | P022628181 | |
| CrebA | DSHB | CrebA Rbt-PC | Antisera. 1:50 dilution (rabbit); generated by the Andrew Lab |
| Damiens diet | BioServ | ||
| DAPI | Life Technologies | n/a | 4′,6-diamidino-2-phenylindole; 1:200 dilution. |
| Defibrinated sheep blood | HemoStat | DSB050 | |
| Escherichia coli HT115 (DE3) | |||
| Ethidium bromide | Millipore Sigma | E7637 | |
| High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher Scientific | 4368814 | |
| Isopropyl β-D-1-thiogalactopyranoside | Millipore Sigma | I5502 | |
| JM109 Competent cells | Promega | L2005 | |
| Luria Broth Media | Thermo Fisher Scientific | 10855001 | |
| Mucin 2 | Proteintech | Muc2; 27 675-1-AP | Antisera. 1:100 dilution (mouse). |
| Nanodrop 2000 | Thermo Fisher Scientific | ||
| Nile Red | Sigma | n/a | Lipid dye; 1:50 dilution. |
| Owl EasyCast B2 Mini Gel Horizontal Electrophoresis | Thermo Fisher Scientific | Model B2 | |
| pGEMT easy | Promega | A3600 | |
| Power SYBR-green PCR master MIX | Applied Biosystems | 4367659 | |
| PureLink PCR purification kit | Thermo Fisher Scientific | K31001 | |
| QuantaStudio 6 | Applied Biosystems | ||
| QuantStudio6 Real Time PCR System | Applied Biosystems | ||
| Rab11 | n/a | n/a | Antisera. 1:100 dilution (rabbit); generated by the Andrew Lab |
| Rh-WGA | Vector Labs | n/a | Rhodamine-conjugated wheat germ agglutinin (chitin, O-GlcNAcylation dye); 1:40 dilution |
| Sage | n/a | n/a | Antisera. 1:50 dilution (rat); generated by the Andrew Lab |
| T4 DNA ligase | Promega | M1801 | |
| Tetracycline | Millipore Sigma | 87128 | |
| Trizol | Thermo Fisher Scientific | 15596018 | |
| Zeiss LSM700 fluorescence confocal microscope | Zeiss | ||
| ANTIBODIES | |||
| Chicken anti-Rat IgG (H+L), Alexa Fluor 647 | Thermo Fisher Scientific | A21472 | |
| Goat anti-Mouse IgG (H+L), Alexa Fluor 647 | Thermo Fisher Scientific | A28181 | |
| IgG (H+L) Goat anti-Rabbit, Alexa Fluor 488 | Thermo Fisher Scientific | A27034 | |
| Rabbit anti-Goat IgG (H+L), Alexa Fluor 488 | Thermo Fisher Scientific | A27012 | |
| PRIMERS | |||
| ACT-2f: TACAACTCGATCATGAAGTGCGA | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| ACT-3r: CCCGGGTACATGGTGGTACCGC CGGA |
CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| FKH_RNAi_F: GCCGACTTATGCTTAGCCCA | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| FKH_RNAi_R: TAGCCGTCAATTCCTCCTGC | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| newDSX-f: AGAGGGCGGGGAAATTCTAGT | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| newDSX-r: GGGCTTGTGGCAGTACGAATA | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| S7qf1: AGAACCAGCAGACCACCATC | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
| S7qr1: GCTGCAAACTTCGGCTATTC | CDC Biotechnology Core Facility Branch | n/a | qRT-PCR primer |
References
- Hoa, N. T., Keene, K. M., Olson, K. E., Zheng, L. Characterization of RNA interference in an Anopheles gambiae cell line. Insect Biochemistry and Molecular Biology. 33, 949-957 (2003).
- Caplen, N., Zheng, Z., Falgout, B., Morgan, R. Inhibition of viral gene expression and replication in mosquito cells by dsRNA-triggered RNA interference | Elsevier enhanced reader. Molecular Therapy. 6, 243-251 (2002).
- Brown, A. E., Catteruccia, F. Toward silencing the burden of malaria: progress and prospects for RNAi-based approaches. BioTechniques. , 38-44 (2006).
- Airs, P. M., Bartholomay, L. C. RNA interference for mosquito and mosquito-borne disease control. Insects. 8, (2017).
- Blandin, S., et al. Reverse genetics in the mosquito Anopheles gambiae: targeted disruption of the Defensin gene. EMBO Reports. 3 (9), 852-856 (2002).
- Garver, L., Dimopoulos, G. Protocol for RNAi assays in adult mosquitoes (A. gambiae). Journal of Visualized Experiments: JoVE. (5), e230 (2007).
- Whyard, S., et al. Silencing the buzz: a new approach to population suppression of mosquitoes by feeding larvae double-stranded RNAs. Parasites & Vectors. 8, 96 (2015).
- Wiltshire, R. M., Duman-Scheel, M. Advances in oral RNAi for disease vector mosquito research and control. Current Opinion in Insect Science. 40, 18-23 (2020).
- Taracena, M. L., Hunt, C. M., Benedict, M. Q., Pennington, P. M., Dotson, E. M. Downregulation of female doublesex expression by oral-mediated RNA interference reduces number and fitness of Anopheles gambiae adult females. Parasites & Vectors. 12, 170 (2019).
- Grassi, B. Studi di uno zoologo sulla malaria. Real Accademia dei Lincei. 3, 229 (1901).
- Smith, R. C., Jacobs-lorena, M. Plasmodium – Mosquito interactions: A tale of roadblocks and detours. Advances in Insect Physiology. 39, (2010).
- Das, S., et al. Transcriptomic and functional analysis of the Anopheles gambiae salivary gland in relation to blood feeding. BMC Genomics. 11, 1-14 (2010).
- Francischetti, I. M. B., Valenzuela, J. G., Pham, V. M., Garfield, M. K., Ribeiro, J. M. C. Toward a catalog for the transcripts and proteins (sialome) from the salivary gland of the malaria vector Anopheles gambiae. Journal of Experimental Biology. 205, 2429-2451 (2002).
- Henderson, K. D., Isaac, D. D., Andrew, D. J. Cell fate specification in thedrosophila salivary gland: The integration of homeotic gene function with the DPP signaling cascade. 발생학. 205, 10-21 (1999).
- Mach, V., Ohno, K., Kokubo, H., Suzuki, Y. The Drosophila fork head factor directly controls larval salivary gland-specific expression of the glue protein gene Sgs3. Nucleic Acids Research. 24 (12), 2387-2394 (1996).
- Weiserova, M., et al. Mini-Mu transposition of bacterial genes on the transmissible plasmid. Folia Microbiologica. 32 (5), 368-375 (1987).
- Abrams, E. W., Mihoulides, W. K., Andrew, D. J. Fork head and Sage maintain a uniform and patent salivary gland lumen through regulation of two downstream target genes, PH4αSG1 and PH4αSG2. Development. 133, 3517-3527 (2006).
- Myat, M. M., Isaac, P. P., Andrew, D. J. Early genes required for salivary gland fate determination and morphogenesis in Drosophila melanogaster. Advances in Dental Research. 14, 89-98 (2000).
- Fox, R. M., Vaishnavi, A., Maruyama, R., Andrew, D. J. Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA. Development of Cell Biology. 140, 2160-2171 (2013).
- Maruyama, R., Grevengoed, E., Stempniewicz, P., Andrew, D. J. Genome-wide analysis reveals a major role in cell fate maintenance and an unexpected role in endoreduplication for the Drosophila FoxA gene fork head. PLOS ONE. 6, 20901 (2011).
- Johnson, D. M., et al. CrebA increases secretory capacity through direct transcriptional regulation of the secretory machinery, a subset of secretory cargo, and other key regulators. Traffic. 21, 560-577 (2020).
- Fox, R. M., Hanlon, C. D., Andrew, D. J. The CrebA/Creb3-like transcription factors are major and direct regulators of secretory capacity. Journal of Cell Biology. 191, 479-492 (2010).
- Abrams, E. W., Andrew, D. J. CrebA regulates secretory activity in the Drosophila salivary gland and epidermis. Development. 132, 2743-2758 (2005).
- Wells, M. B., Andrew, D. J. Anopheles salivary gland architecture shapes plasmodium sporozoite availability for transmission. mBio. 10 (4), 01238 (2019).
- Pei-Wen, L., Xiao-Cong, L., Jin-Bao, G., Yan, L., Xiao-Guang, C. Molecular cloning, characterization and expression analysis of sex determiantion gene doublesex from Anopheles gambiae (Diptera: Culicidae). Acta Entomologica Sinica. 58 (2), 122-131 (2015).
- Scali, C., Catteruccia, F., Li, Q., Crisanti, A. Identification of sex-specific transcripts of the Anopheles gambiae doublesex gene. The Journal of Experimental Biology. 208, 3701-3709 (2005).
- Price, D. C., Egizi, A., Fonseca, D. M. Characterization of the doublesex gene within the Culex pipiens complex suggests regulatory plasticity at the base of the mosquito sex determination cascade. BMC Evolutionary Biology. 15, 1-13 (2015).
- Mysore, K., et al. siRNA-mediated silencing of doublesex during female development of the dengue vector mosquito Aedes aegypti. PLoS Neglected Tropical Diseases. 9, 1-21 (2015).
- Boisson, B., et al. Gene silencing in mosquito salivary glands by RNAi. FEBS Letters. 580, 1988-1992 (2006).
- Horn, T., Boutros, M. E-RNAi: a web application for the multi-species design of RNAi reagents-2010 update. Nucleic Acids Research. 38, 332-339 (2010).
- Taracena, M. L., et al. Genetically modifying the insect gut microbiota to control chagas disease vectors through systemic RNAi. PLoS Neglected Tropical Diseases. 9, (2015).
- Sambrook, J., Fritsch, E. F., Maniatis, T. . Molecular Cloning: A Laboratory Manual. , (1989).
- Ullmann, A., Jacob, F., Monod, J. Characterization by in vitro complementation of a peptide corresponding to an operator-proximal segment of the β-galactosidase structural gene of Escherichia coli. Journal of Molecular Biology. 24, 339-343 (1967).
- Timmons, L. Bacteria-mediated RNAi-General outline. Carnegie Institution of Washington. , (2000).
- Pfaffl, M. W. Relative quantification. Real-time PCR. , 63-82 (2004).
- Neira-Oviedo, M., et al. The RNA-Seq approach to studying the expression of mosquito mitochondrial genes. Insect Molecular Biology. 20, 141-152 (2011).
- Baker, D. A., et al. A comprehensive gene expression atlas of sex- and tissue-specificity in the malaria vector, Anopheles gambiae. BMC Genomics. 12, (2011).
- Loganathan, R., Hoon, J., Wells, M. B., Andrew, D. J. Secrets of secretion – How studies of the Drosophila salivary gland have informed our understanding of the cellular networks underlying secretory organ form and function. Cellular Networks in Development. , 143 (2021).
- Chung, S., Hanlon, C. D., Andrew, D. J. Building and specializing epithelial tubular organs: The Drosophila salivary gland as a model system for revealing how epithelial organs are specified, form and specialize. Wiley Interdisciplinary Reviews: Developmental Biology. 3, 281-300 (2014).
- Yoshida, S., et al. Inhibition of collagen-induced platelet aggregation by anopheline antiplatelet protein, a saliva protein from a malaria vector mosquito. Blood. 111, 2007-2014 (2008).
- Wells, M. B., Villamor, J., Andrew, D. J. Salivary gland maturation and duct formation in the African malaria mosquito Anopheles gambiae. Scientific Reports. 7 (1), 601 (2017).
- Takahashi, S., et al. Rab11 regulates exocytosis of recycling vesicles at the plasma membrane. Journal of Cell Science. 125, 4049-4057 (2012).
- Catteruccia, F., Levashina, E. A. RNAi in the malaria vector, Anopheles gambiae. Methods in Molecular Biology. 555, 63-75 (2009).
- Balakrishna Pillai, A., et al. RNA interference in mosquito: understanding immune responses, double-stranded RNA delivery systems and potential applications in vector control. Insect Molecular Biology. 26, 127-139 (2017).
- Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in caenorhabditis elegans. Nature. 391, 806-811 (1998).
- Kamath, R. S., Ahringer, J. Genome-wide RNAi screening in Caenorhabditis elegans. Methods. 30, 313-321 (2003).
- Kamath, R. S., et al. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature. 421, 231-237 (2003).
- Carrasco, D., et al. Behavioural adaptations of mosquito vectors to insecticide control. Current Opinion in Insect Science. 34, 48-54 (2019).
- Magalhaes, T., et al. Induction of RNA interference to block Zika virus replication and transmission in the mosquito Aedes aegypti. Insect Biochemistry and Molecular Biology. , 111 (2019).
