Isolation, Vermehrung und Prion-Protein-Expression während neuronaler Differenzierung von Stammzellen menschlichen Zahnpulpa
Summary
Hier präsentieren wir ein Protokoll für die menschlichen Dental Pulp Stammzellen isoliert und Vermehrung um das Prion-Protein-Expression bei neuronalen Differenzierungsprozess zu bewerten.
Abstract
Bioethische Fragen im Zusammenhang mit der Manipulation von embryonalen Stammzellen haben Fortschritte auf dem Gebiet der medizinischen Forschung behindert. Aus diesem Grund ist es sehr wichtig, adulten Stammzellen aus verschiedenen Geweben wie Fettgewebe, Nabelschnurblut, Knochenmark und Blut zu erhalten. Zu den möglichen Quellen ist Zahnpulpa besonders interessant, weil es einfach ist, in Bezug auf bioethische Aspekte zu erhalten. In der Tat Dental Pulp Stammzellen (hDPSCs) sind eine Art von adulten Stammzellen in neuronalen-ähnliche Zellen zu unterscheiden und kann der dritte Molar von gesunden Patienten (im Alter von 13-19) entnommen werden. Insbesondere wurde die Pulpa entfernt mit einem Bagger, in kleine Scheiben schneiden, mit Kollagenase IV behandelt und kultiviert in einem Kolben. Um die neuronale Differenzierung zu induzieren, wurden hDPSCs für 2 Wochen mit EGF/bFGF stimuliert. Bisher haben wir gezeigt, dass bei der Differenzierung der Gehalt an zellulären Prion Protein (PrPC) in hDPSCs erhöht. Die Cytofluorimetric Analyse zeigte frühen Ausdruck der PrPC , die nach neuronalen Differenzierungsprozess erhöht. Ablation von PrPC von SiRNA verhindert PrP neuronaler Differenzierung induziert durch EGF/bFGF. In diesem Beitrag zeigen wir, dass wir verstärkte Isolation, Trennung und in-vitro- Kultivierung Methoden der hDPSCs mit einige einfache Verfahren, effizientere Zellklonen erhaltenen und groß angelegte Erweiterung der mesenchymalen Stammzellen (MSCs) waren wurde beobachtet. Wir zeigen auch, wie die hDPSCs, mit Methoden, die gemäß des Protokolls erhalten sind ein ausgezeichnetes experimentelles Modell neuronaler Differenzierung der MSCs und anschließende zelluläre und molekulare Prozesse zu studieren.
Introduction
Mesenchymaler Stammzellen wurden isoliert aus verschiedenen Geweben, einschließlich Knochenmark, Nabelschnurblut, menschliche Zahnpulpa, Fettgewebe und Blut1,2,3,4,5 , 6. wie von mehreren Autoren berichtet, zeigen hDPSCs Kunststoff festhalten, eine typische Fibroblasten-ähnliche Morphologie. Diese stellen eine sehr heterogene Bevölkerung mit verschiedenen Klonen und Unterschiede in der proliferativen und differenzierenden Kapazität7,8. hDPSCs express spezifischer Marker für mesenchymale Stammzellen (d.h. CD44, CD90, CD73, CD105, STRO-1), sie sind negativ für einige hämatopoetischen Marker (z. B. CD14 und CD19) und sind in der Lage, in-vitro-multilineage Differenzierung9, 10,11.
Mehrere Autoren haben gezeigt, dass diese Zellen in der Lage sind zu differenzieren in Neuron-wie Zellen mit verschiedenen Protokollen, die den Zusatz von NGF, bFGF, EGF in Kombination mit den spezifischen Medien und Ergänzungen7,–12enthalten. Auch viele Proteine während neuronaler Differenzierungsprozess beteiligt sind, und unter diesen sind mehrere Papiere zeigen eine wichtige Rolle und Ausdruck des zellulären Prion-Proteins (PrPC), beide in embryonalen und adulten Stammzellen13, 14. PrPC stellt einen pleiotropen Molekül in der Lage verschiedene Funktionen innerhalb der Zellen als Kupfermetabolismus, Apoptose, und Widerstand gegen oxidativen stress15,16,17 , 18 , 19 , 20 , 21 , 22.
In unseren bisherigen Papier23untersuchten wir die Rolle von PrPC in den hDPSCs neuronalen Differenzierungsprozess. In der Tat hDPSCs express altklug PrPC und nach neuronaler Differenzierung war es möglich, eine zusätzliche Erhöhung zu beobachten. Andere Autoren die Hypothese auf einer möglichen Rolle von PrPC in neuronale Differenzierungsprozesse von Stammzellen. In der Tat treibt PrPC die Differenzierung von humanen embryonalen Stammzellen in Neuronen, Oligodendrozyten und Astrozyten24. Der Zweck dieser Studie war, die Methodik für die Gewinnung von Stammzellen aus Zahnpulpa, seine Differenzierungsprozess und die Rolle der PrPC während neuronaler Differenzierung zu betonen.
Protocol
Representative Results
Discussion
Dabei konzentrierten wir uns auf Methoden zur Isolierung und neuronale Differenzierung der hDPSCs; Darüber hinaus haben wir die Rolle des PrPC in diesem Prozess ausgewertet. Es gibt verschiedene Methoden, zu isolieren und hDPSCs in Neuron-wie Zellen und kritischen Schritte während des Prozesses zu unterscheiden. hDPSCs sind in der Lage, mehrere Linien wie Neuronen, Chondroblasten, Adipozyten und Osteoblasten differenzieren. In unserem Paper untersuchten wir die Mechanismen der neuronale Differenzierung und d…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Diese Arbeit wurde von der “Fondazione Varrone” und Rieti Universität Hub “Sabina Universitas” zu Vincenzo Mattei unterstützt.
Abbildung 5 (A, B) abgedruckt mit freundlicher Genehmigung des Verlags Taylor & Francis Ltd aus: Rolle des Prion-Protein-EGFR multimolecular Komplex während neuronaler Differenzierung der menschlichen dental Pulp-Stammzellen. Martellucci, S., Manganelli V. C. Santacroce, Santilli F., Piccoli L., M. Sorice Mattei V. Prion. 2018 4 Mar. Taylor & Francis Ltd.
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
References
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
