고전적인 Hodgkin 림프종의 Reed-Sternberg 세포의 흐름 정렬 및 Exome 시퀀싱
Summary
여기에서는 고전적인 Hodgkin lymphoma (CHL)의 Hodgkin Reed-Sternberg (HRS) 세포로부터 고품질, 전체 exome 데이터를 생산하도록 고안된 결합 된 유동 세포 계측법 세포 분류 및 저 입력, 차세대 라이브러리 구성 프로토콜을 설명합니다.
Abstract
고전적인 Hodgkin 림프종의 Hodgkin Reed-Sternberg 세포는 염증성 림프구의 배경 내에 희박하게 분포하며 전형적으로 종양 질량의 1 % 미만을 구성합니다. 벌크 종양에서 유래 한 물질은 특성화하기에 충분하지 않은 농도의 종양 함량을 포함합니다. 따라서 8 개의 항체를 이용한 형광 활성 세포 선별 및 측방 및 전방 산란은 후속 연구를 위해 종양에서 수천 개의 HRS 세포를 신속하게 분리 및 농축하는 방법으로 여기에 설명됩니다. 동시에 exome 시퀀싱을위한 표준 프로토콜은 일반적으로 흐름 정렬을 사용하는 경우에도 종종 100-1000 ng의 입력 DNA를 필요로하기 때문에 우리는 고품질의 생산이 가능한 최적화 된 저 입력 라이브러리 구성 프로토콜을 제공합니다 최소 10 ng의 입력 DNA로부터의 데이터. 이 조합은 전체 전자의 하이브리드 화 캡처에 적합한 차세대 라이브러리를 생성 할 수 있습니다.xome baits 또는 더 집중된 대상 패널을 원하는대로 선택할 수 있습니다. 건강한 종양의 T 또는 B 세포와 비교할 때 HRS 세포의 exome sequencing은 돌연변이, 삽입 및 결실, 사본 번호 변경을 포함한 신체적 변화를 확인할 수 있습니다. 이러한 발견은 HRS 세포의 분자 생물학을 밝혀주고 표적 약물 치료를위한 방법을 제시 할 수 있습니다.
Introduction
차세대 시퀀싱의 결과로서의 암 유전체학의 진보는 치료 표적의 확인 및 많은 혈액학 및 비 혈액 종양의 예후에 중요한 돌파구를 가져왔다. 특정 게놈 변형에 기초한 새로운 개별 치료 전략이 많은 종양 유형에 급속히 도입되고있다 (참고 문헌 1 , 2 에서 검토 됨). 림프종 유전체학에서 상당한 발전에도 불구하고, 고전적 Hodgkin lymphoma (CHL)에서 종양 HRS 세포의 게놈은 과소 평가되었다. 이 연구는 반응성 미세 환경 내에서 신생 HRS 세포의 부족으로 인해 어려움을 겪었으므로 정제 된 HRS 세포 집단을 분리하기가 어렵습니다 3 .
원발성 종양에서 생존 가능한 HRS 세포를 분리하는 방법은 Fromm et al. 도 4에 도시 된 바와 같이,이 방법은 CD30, CD15, CD40, CD95, CD45 CD20, CD5 및 CD64로 구성된 8 가지 항체 칵테일을 사용하여 CHL 종양 현탁액에서 HRS 세포를 확실하게 식별합니다. 는 적어도 10 7 개의 세포 (약 10 mg 조직)로 구성된 종양 생검에서 얻은 신선 또는 고정 세포 현탁액에서 최소 1,000 개의 생존 가능한 HRS 세포를 분리 할 수 있습니다. 순도는 유세포 분석을 통해 90 % 이상이며 10 개의 연속적인 사례의 exome 게놈 분석에 의해 최소 80 %.
당사는 초기의 CHL 종양에서 수천 개의 생존 가능한 HRS 세포를 신속하게 분리 할 수 있도록 프로세스를 대폭 개선 한 유세포 분석기 분리 기술을 개선했습니다. 우리는 호 지킨 림프종의 일차적 인 경우에서 종양 세포의 첫 번째 전체 exome 서열로 여겨지는 것을 생산하는 기술을 이용했습니다. 우리의 연구는 일개별적인 CHL 사례에 대한 높은 처리량, 게놈 차원의 연구의 타당성 및 CHL 발병 기전의 측면을 설명 할 수있는 잠재력을 지닌 새로운 게놈 변형의 확인을 이끌어 냈다.
우리는 고 처리량 게놈 연구를 위해 추출 된 DNA를 활용하는 파이프 라인을 개발했습니다. 순차적으로 발견 된 최소 1,000 개의 HRS 세포로부터 안정적인 결과를 얻기 위해 Adaptor Ligation 효율을 높이고 DNA 단편 라이브러리를 생성 할 수있는 변형 된 차세대 DNA 라이브러리 제작 절차 8 을 개발했습니다 과도한 증폭없이. 이 방법은 일상적인 임상 시료의 분석과 재발 성 돌연변이 및 염색체 변형의 검출을 가능하게합니다 7 .
Protocol
Representative Results
Discussion
이 기술을 습득 한 이후의 응용 프로그램 또는 지시 사항
이 작품은 적어도 10 NG의 DNA를 포함하는 샘플에서 exome 시퀀싱을 허용합니다. 임상 적 맥락에서이 한계는 불충분 한 물질로 인해 대부분의 미세 바늘 흡인 표본을 제외하지만 적절한 핵심 생검 및 절제 생검 표본을 포함합니다. 이렇게하면 더 많은 샘플 세트에서 데이터를 수집 할 수 있습니다.
<p class="j…Disclosures
The authors have nothing to disclose.
Acknowledgements
이 프로젝트 방법의 개발은 Weill Cornell Medical College의 병리학 및 실험 의학과에서 지원되었습니다. 우리는 전산 생물학 및 의학에서의 삼중 제도 연수 프로그램을 부분 기금으로 인정합니다. 우리는 시간과 지식을 우리와 공유 한 과학자, 특히 Maryke Appel에게 감사드립니다. Dan Burgess; 일간카 코자 레와; 차드로 클리어; Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson 및 Tuo Zhang을 포함하여 Weill Cornell Medical College Genomics 핵심 시설의 모든 사람들이 있습니다.
Materials
| Petri or Cell Culture Dish (sterile) | |||
| RPMI-1640 Media | Roswell Park Memorial Institute | ||
| Fetal Calf Serum (FCS), (heat inactivated) | |||
| Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile | |||
| RPMI with 2% FCS (make fresh or store for up to 1 month) | |||
| scalpel with fresh blade | |||
| 10 ml syringe (no needle) | |||
| Cryogenic vials | |||
| 50 ml conical centrifuge tubes, force | |||
| Centrifuge | capable of handling 50 ml conical centrifuge tubes and providing 400g | ||
| Hepes buffer(1M, cell culture grade) | |||
| phosphate buffered saline (PBS) | |||
| Pluoronic-F68 | Thermo-Fisher | 24040-032 | |
| DNAase-I | Sigma-Aldrich, St. Louis, MO | D4527-10KU | store as 5mg/ml in RPMI in -200C |
| Bovine Serum Albumin (BSA) | |||
| Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic –F68 (1X)) | |||
| CD64-FITC (22) | Beckman Coulter, Miami, FL | 20 uL suggested starting volume; Titering is suggested | |
| CD30-PE (BerH83) | BD Biosciences, San Jose, CA | 20 uL suggested starting volume; Titering is suggested | |
| CD5-ECD (BL1a) | Beckman Coulter, Miami, FL | 10 uL suggested starting volume; Titering is suggested | |
| CD40-PerCP-eFluor 710 (1C10) | Ebiosciences, San Diego, CA | 5 uL suggested starting volume; Titering is suggested | |
| CD20-PC7 (B9E9) | Beckman Coulter, Miami, FL | 10 uL suggested starting volume; Titering is suggested | |
| CD15-APC (HI98) | BD Biosciences, San Jose, CA | 20 uL suggested starting volume; Titering is suggested | |
| CD45 APC-H7 (2D1) | BD Biosciences, San Jose, CA | Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested | |
| CD95-Pacific Blue (DX2) | Life Technologies, Grand Island, NY | 5 uL suggested starting volume; Titering is suggested | |
| CD2 (5 μg; clone RPA-2.10) | Biolegend, San Diego, CA | For optional protocol; Titering is suggested | |
| CD54 (10 μg; clone 84H10) | Serotec, Oxford, United Kingdom | For optional protocol; Titering is suggested | |
| CD58 (10 μg; clone TS2/9) | eBioscience, San Diego, CA | For optional protocol; Titering is suggested | |
| LFA-1 (12 μg; clone MHM23) | Novus Biologicals, Littleton, CO | For optional protocol; Titering is suggested | |
| BD CS&T Beads | BD Biosciences, San Jose, CA | ||
| BD Accudrop Beads | BD Biosciences, San Jose, CA | ||
| BC Versa Comp antibody capture beads | Beckman Coulter, Miami, FL | Compensation Beads | |
| BD-FACS ARIA special research order instrument using 5 lasers | BD Biosciences, San Jose, CA | any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient | |
| Wizard | Promega | A2360 | |
| 10 mM Tris-Cl buffer | NA | ||
| Qubit dsDNA HS Assay kit | Life Technologies, Carlsbad, CA | ||
| S2 Sonicator | Covaris, Woburn, MA | Alternatives may be substituted | |
| microTUBE | Covaris, Woburn, MA | ||
| Low-Throughput Library Preparation Kit | Kapa Biosystems, Wilmington, MA | KK8221 | |
| Sybr Green | Sigma-Aldrich, St. Louis, MO | S9430 | |
| Agencourt AMPure XP Beads | Beckman Coulter, Miami, FL | ||
| Bioanalyzer | Agilent Technologies, Santa Clara, CA | ||
| SeqCap EZ Exome v.3.0 | Roche Nimblegen | 6465684001 | |
| HiSeq | Illumina | ||
| TruSeq-style Universal adapter | Integrated DNA Technologies (IDT), Coralville, Iowa | HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T | |
| TruSeq-style index adapter | Integrated DNA Technologies (IDT), Coralville, Iowa | HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG | |
| TruSeq-style PCR primer 1 | Integrated DNA Technologies (IDT), Coralville, Iowa | AATGATACGGCGACCACCGAGA | |
| TruSeq-style PCR primer 2 | Integrated DNA Technologies (IDT), Coralville, Iowa | CAAGCAGAAGACGGCATACGAG | |
| Nuclease Free Duplex Buffer | Integrated DNA Technologies (IDT), Coralville, Iowa | ||
| BD FACSDIVA software | BD Biosciences, San Jose, CA | ||
| BD Falcon Tubes | BD Biosciences, San Jose, CA | ||
| BD Flow Tubes | BD Biosciences, San Jose, CA | ||
References
- Abrams, J. National Cancer Institute’s Precision Medicine Initiatives for the new National Clinical Trials Network. American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).
- Gagan, J., Van Allen, E. M. Next-generation sequencing to guide cancer therapy. Genome medicine. 7, 80 (2015).
- Matsuki, E., Younes, A. Lymphomagenesis in Hodgkin lymphoma. Seminars in cancer biology. 34, 14-21 (2015).
- Fromm, J. R., Kussick, S. J., Wood, B. L. Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting. Am J Clin Pathol. 126 (5), 764-780 (2006).
- Fromm, J. R., Thomas, A., Wood, B. L. Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity. Am J Clin Pathol. 131 (3), 322-332 (2009).
- Roshal, M., Wood, B. L., Fromm, J. R. Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications. Advances in hematology. 2011, 387034 (2011).
- Reichel, J., et al. Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells. Blood. 125 (7), 1061-1072 (2015).
- Kozarewa, I. A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA. PLoS ONE. 7 (3), e32617 (2012).
- Brunicardi, F. C. . Schwartz’s Principles of Surgery. , (2014).
- Kantor, A. B., Roederer, M. FACS analysis of leukocytes. Handbook of Experimental Immunology. 2, (1996).
- Sanders, M. E. Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin’s cell line L428. Cancer Res. 48 (1), 37-40 (1988).
- Biosciences. . FACSAria II User’s Guide. Part No. 644832, Revision A. , (2009).
- . Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: https://www.thermofisher.com/order/catalog/product/Q33216 (2017)
- Roche Nimblegen. . SeqCap EZ Library SR User’s Guide ver. 4.1. , (2013).
- Li, H., Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25 (14), 1754-1760 (2009).
- Li, H. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25 (16), 2078-2079 (2009).
- Saunders, C. T. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 28 (14), 1811-1817 (2012).
- Cingolani, P., et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin). 6 (2), 80-92 (2012).
- Dobin, A. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29 (1), 15-21 (2013).
- Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 14 (2), 178-192 (2013).
- . DNA copy number data analysis. v.R package version 1.34.0 Available from: https://omictools.com/dnacopy-tool (2013)
