Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.
Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm’s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.
Globale Hühnerproduktion Zehnfache über den letzten 50 Jahren mit den Entwicklungsländern Hosting fast viermal die Expansion in den Industrieländern erlebt erhöht (www.faostat.org) . Da die Bedeutung der Hühnerproduktion zur Welternährungssicherheit hat sich so hat auch das Profil von Erregern, die schwere Krankheit bei Hühnern verursachen können. Ein gutes Beispiel sind die Eimeria-Arten, allgegenwärtigen einzellige Parasiten, die die Darmerkrankung Kokzidiose 1 führen können. Wo immer Hühnern gezüchtet werden ein oder mehrere Eimeria-Spezies wahrscheinlich gemeinsame 2-4 sein. In der entwickelten Welt Eimeria werden vor allem von Chemoprophylaxe kontrolliert und beschäftigt Shuttle oder Rotationsprogramme, die Auswirkungen der Widerstand 5 zu minimieren. Lebendimpfstoffe sind auch in Systemen, in denen Vogel Wert ist ausreichend, um die Kosten zu rechtfertigen (zB, Zuchttiere, Schichten und einige Broilern 5). Als result dieser Maßnahmen klinischen Kokzidiose wird oft gut kontrolliert, auch wenn subklinische Infektion ist häufig 5. In den Entwicklungsländern die Impfung ist selten und Drug Application häufig weniger gut informiert. Als Folge subklinischen und klinischen Kokzidiose ist häufiger und übt eine erhebliche wirtschaftliche Auswirkungen 3.
Diagnose von Eimeria-Infektion traditionell auf Läsion Scoring post-mortem, obwohl auch die Autoren der am häufigsten verwendeten Bewertungssystem kommentierte, dass für einige Arten "es erscheint zweifelhaft, ob eine solche Regelung sollte in jedem, aber mittelschweren Infektionen versucht werden" 6. Ergänzende Hinweise können durch mikroskopische Nachweis des umweltbeständig Oozyste Lebenszyklusphase in Fäkalien oder Wurf Proben gesammelt werden, auch wenn sich überlappenden Morphologie können alle, aber die Experten 6,7 verwechseln. Molekulare Alternativen mittels Polymerase-Kettenreaktion (PCR), Zufalls amplification polymorpher DNA PCR (RAPD-PCR) und die quantitative PCR-Technologien wurden für bis zu 20 Jahre 8-10 zur Verfügung, aber sie bislang gescheitert populär geworden. Relative Kosten und der Bedarf an Fachlaborgeräte oder Verarbeitung ihre Aufnahme beschränkt, trotz der oft subjektiv und technisch anspruchsvolle Art des älteren pathology- und Mikroskopie-basierte Ansätze 10,11. Eine solche Beschränkung kann in vielen der ärmeren Regionen der Welt, wie Südostasien, wo die Auswirkungen der Kokzidiose auf die Armut kann proportional größer 12 sein übertrieben werden. Als Antwort gibt es einen klaren Bedarf an neuen unkompliziert und empfindlich, aber kostengünstiger, Eimeria-Spezies-spezifische diagnostische Tests.
Loop-vermittelte isothermische Amplifikation (LAMP) ist ein leicht zu DNA-Polymerase-angetriebene Technik, die zur Amplifikation großer Mengen an DNA herzustellen. Am wichtigsten ist, verwendet LAMP eine Bst DNA polymerase anstelle der Taq-DNA-Polymerase die üblicherweise in PCR verwendet werden, die DNA-Amplifizierung bei einer einzigen konstanten Temperatur ermöglicht, ohne das Erfordernis der thermischen Zyklen 13,14. Leuchte kann selbst in den rudimentären Labor oder im Feld zugänglich Anwendung sein. Durch eine relative Beständigkeit gegenüber vielen PCR-Inhibitoren, hohe Empfindlichkeit und Spezifität Charakterisiert wurden LAMP-Assays für ein breites Spektrum von Krankheitserregern einschließlich Virus der infektiösen Bursitis, Clostridium perfringens und Cryptosporidium 15-17 entwickelt. In Reaktion auf neue kosteneffektive Eimeriaspezies spezifische Diagnose ein Panel von spezifisch jede der sieben Eimeria-Spezies, die Hühner infizieren LAMP-Assays entwickelt worden, 18 verlangen. Anwendungen für die neuen Tests umfassen die Überwachung Parasiten Auftreten, von besonderem Wert, da die Zuordnung der Arten wie Eimeria maxima oder Eimeria necatrix mit schlechten wirtschaftlichen performance 3,4. Weitere Anwendungen sind die Beurteilung der Wirksamkeit von Antikokzidium Strategie eines Bauernhof, Diagnose subklinische Infektion oder klinischen Erkrankung und Bewertung von Risiken durch Eimeria zu einem Bauernhof gestellt.
The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~£0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment.
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25.
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.
The authors have nothing to disclose.
The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.
Name | Company | Catalogue number | Comments |
RNAlater | Ambion | AM7024 | |
Ethanol | VWR Chemicals | 20821.321 | Caution, highly flammable |
100 x Tris-EDTA (TE) buffer concentrate | Sigma-Aldrich | T9285 | |
Chelex 100 resin | Bio-Rad | 142-1253 | |
Molecular grade water | Invitrogen | 10977035 | |
E. acervulina F3 | Sigma-Aldrich | VC00021 | *CCTAACATTTCGCTTCACGGAC |
E. acervulina B3 | Sigma-Aldrich | VC00021 | *ATGAGCAAGTGGAACACCTTG |
E. acervulina FIP | Sigma-Aldrich | VC00021 | *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT |
E. acervulina BIP | Sigma-Aldrich | VC00021 | *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG |
E. acervulina LB | Sigma-Aldrich | VC00021 | *TAAGGTTACACCCGTGGAGG |
E. acervulina LF | Sigma-Aldrich | VC00021 | *GCCATGCACAAAGCGACTT |
E. brunetti F3 | Sigma-Aldrich | VC00021 | *GGCCATCAAGTTCCATGAGC |
E. brunetti B3 | Sigma-Aldrich | VC00021 | *TCAACCTCCTGAGTGTGGTT |
E. brunetti FIP | Sigma-Aldrich | VC00021 | *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT |
E. brunetti BIP | Sigma-Aldrich | VC00021 | *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC |
E. brunetti LB | Sigma-Aldrich | VC00021 | *GAAACGCTCGAACATGGC |
E. brunetti LF | Sigma-Aldrich | VC00021 | *CTTCTCCACAGACCCAGAGGT |
E. maxima F3 | Sigma-Aldrich | VC00021 | *ACTACGGAAAAGTGCGTAGCT |
E. maxima B3 | Sigma-Aldrich | VC00021 | *CCTTCCTCCCTTCTGAAAACTG |
E. maxima FIP | Sigma-Aldrich | VC00021 | *GAGTCACTGCTGATGTACCAAA AG-GAACTATGCCGCTTTCCCCTG |
E. maxima BIP | Sigma-Aldrich | VC00021 | *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA |
E. maxima LB | Sigma-Aldrich | VC00021 | *CAAGCCTACGCGGACATC |
E. maxima LF | Sigma-Aldrich | VC00021 | *TTATGCAGCTGGGTCAACG |
E. mitis F3 | Sigma-Aldrich | VC00021 | *ACGATAGCCAAGACACGTAAGG |
E. mitis B3 | Sigma-Aldrich | VC00021 | *CCCCGTGATAAGAGTAGGAACA |
E. mitis FIP | Sigma-Aldrich | VC00021 | *CGCGGGTCGTGAGATTTAAATT AT-GGAAGATCAGGACGGGCACT |
E. mitis BIP | Sigma-Aldrich | VC00021 | *GTTTCAGTTGATGAACAAGCGA GA-TGCGCCTCTAGAATCAAGACG |
E. mitis LB | Sigma-Aldrich | VC00021 | *TCCATGCATCCCCTTGTT |
E. mitis LF | Sigma-Aldrich | VC00021 | *CGTGGGCACAGATTGATTC |
E. necatrix F3 | Sigma-Aldrich | VC00021 | *TGGCTTTCCCGCGTACC |
E. necatrix B3 | Sigma-Aldrich | VC00021 | *CGGCCCAACACAAAGACTG |
E. necatrix FIP | Sigma-Aldrich | VC00021 | *CGCTTGAGTTTTAAGCTATGCA CA-GACCCAAGCAGCTCACCAA |
E. necatrix BIP | Sigma-Aldrich | VC00021 | *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC |
E. necatrix LB | Sigma-Aldrich | VC00021 | *GTCTGTAACTTGGGACGTTGT |
E. necatrix LF | Sigma-Aldrich | VC00021 | *GAACAGCCGGAGCCTCTC |
E. praecox F3 | Sigma-Aldrich | VC00021 | *GCCCTTGTATGTTGCTGTTTCT |
E. praecox B3 | Sigma-Aldrich | VC00021 | *GCGCACGAATCTGAATCACAC |
E. praecox FIP | Sigma-Aldrich | VC00021 | *ATCTCCTCAAAGACTTTCGCGT A-GCGCTTGGCTATATCCATAGG |
E. praecox BIP | Sigma-Aldrich | VC00021 | *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT |
E. praecox LB | Sigma-Aldrich | VC00021 | *GAATAGCATTGCCAGGTGG |
E. praecox LF | Sigma-Aldrich | VC00021 | *GTCCACTGTCATTAATATTGC TGC |
E. tenella F3 | Sigma-Aldrich | VC00021 | *GCTTGTGAAGGTCAGCGTG |
E. tenella B3 | Sigma-Aldrich | VC00021 | *GCTGAGTCCATACGTACTTCCT |
E. tenella FIP | Sigma-Aldrich | VC00021 | *GCCACTGCTATGGAAAGTCAC AC-CATAACTGGCATGCAGGGGT |
E. tenella BIP | Sigma-Aldrich | VC00021 | *GTTTGGCCCGAAAGTTGTGAA GA-CGTCAGAAATTGCTGCCCAAT |
E. tenella LB | Sigma-Aldrich | VC00021 | *CGCATGTGCAGTTGAAGACA |
E. tenella LF | Sigma-Aldrich | VC00021 | *CCAAATGTATCTGCTAGTTATA TTAACAAG |
10 x ThermoPol reaction buffer | New England Biolabs | B9004S | |
MgSO4 | Sigma-Aldrich | M7506 | |
dNTPs | Promega | U1330 | |
Betaine solution (5 M) | Sigma-Aldrich | B0300 | |
Bst polymerase | New England Biolabs | M0275S | |
Hydroxynaphthol blue | Sigma-Aldrich | 33936 | Dissolved in molecular grade water. |
UltraPure agarose | Invitrogen | 16500-500 | |
10 x Tris/Borate/EDTA (TBE) buffer | Invitrogen | AM9863 | |
Blue/Orange DNA loading dye (x6) | Promega | G1881 | |
GeneRuler 1Kb DNA ladder | Thermo Scientific | SM0313 | |
SafeView nucleic acid stain | NBS Biologicals | NBS-SV |