Microinjection of CRISPR/Cas9 Protein into Channel Catfish, Ictalurus punctatus, Embryos for Gene Editing

This experiment was conducted at the Fish Genetics Research Unit, E. W. Shell Fisheries Research Center, Auburn University, AL. All experimental protocols used in this experiment were approved by the Auburn University Institutional Animal Care and Use Committee (AU-IACUC) before the experiment was initiated. A list of the equipment and supplies used in this experiment can be found in the Materials Table. The following are the steps and procedures for preparation and microinjection of channel catfish one-cell embryos as illustrated in Figure 1.

1. Brood Stock Selection and Spawning

1. Choose healthy channel catfish brood stock from the strain or genetic line of interest. Channel catfish males and females should exhibit good secondary sex characteristics.
2. Select males that have a broad muscular head that is wider than the rest of their bodies with well-developed genital papilla. Dark color, scarring and wounds from territorial fighting are also signs of sexual readiness. Select females that have heads that are narrower than the rest of their bodies, and have soft, palpable, well-rounded abdomen. For accuracy and to avoid stressing the fish during initial handling, stop feeding the females 2-3 days before examining their readiness for spawning.
3. Perform fish handling quickly, but carefully. To reduce handling stress, perform all procedures that require handling females while holding fish in spawning bags (32 mm size mesh).
4. Just before hormone injection to induce ovulation, measure the body weight of the females.
5. Hang the spawning bags with females inside in a flow through tank with continuous water flow and adequate aeration.
6. Aseptically, load the implanter that has a 14 G needle with 85 µg/kg of luteinizing hormone releasing hormone analog (LHRHa) implant. Rinse the injection site (dorsal musculature) with 0.9% sterile saline solution before the injection. Insert the implanter at a 45° angle and release the implant. Withdraw the needle and swipe the injection site with a cotton ball previously soaked in 70% ethanol.
7. Place the spawning bag in the holding tank so that the fish is completely submerged in water 15-20 cm below the water surface. Adequate aeration (above 5 ppm dissolved oxygen) and good water quality are important for ovulation of high quality eggs.
8. Predict the ovulation time based on the water temperature using the degree-hour (h) relationship³⁵. Degree-h response time = time between hormone injection and ovulation (h) * water temperature (°C). For example, for a degree-h response time of 900-1,000, a female is expected to spawn at 36-40 h from hormone injection time at 25 °C. Usually, the first check for eggs is done at about 36 h after hormone injection and then at 4 h interval.
9. To check for ovulation, gently lift the spawning bag above the water surface while you are looking for the eggs that are attached inside the spawning bag. Seeing at least 10 eggs indicates this female is ovulating and ready for hand stripping.

2. Sperm Preparation

NOTE: Sperm can be prepared a few h before the expected ovulation time.

1. Euthanize males by a percussive blow to the head without anesthesia, since anesthesia might have a negative effect on sperm motility.
2. Collect the testes in a small weighing pan, remove any tissue, and wash them with 50-mL of 0.9% saline to remove blood, if necessary. Well-developed testes are white with many villiform projections ( Figure 2).
3. Determine the weight of the testes.
4. To prepare the sperm solution for egg fertilization, transfer the testes to the center of a 100 cm² 100 µm mesh using forceps. Fold the mesh with the testes inside, crush the testes and filter the sperm into a 50 mL collection tube. This can be done by applying pressure to testes inside the mesh against the rim of the collection tube via the thumb. Use 0.9% saline solution to wash the sperm from the mesh into the collection tube. Saline solution can be added up to 10 mL/g of testes.
5. Determine the concentration of the sperm, check the motility and viability.
   NOTE: Concentration can be determined by counting the sperm cells in a known diluted volume of milt using a hemocytometer. Alternatively, the sperm density can be estimated by evaluating the optical density of milt using a spectrophotometer. In this method, the absorption at 505 nm wavelength is compared to a control chart that has been previously prepared for the absorption of different concentrations of sperm³⁶. Sperm motility can be checked under the microscope as the time from activation of the sperm until cessation of sperm movement (called motility duration)³⁷. The viability of sperm can be determined by staining the sperm with selective dyes such as trypan blue, which will stain only non-viable sperm cells, while viable sperm will remain unstained. However, for these microinjection procedures, this is not necessary if the testes are well developed.
6. Store sperm in 0.9% saline from step 2.5 at 4 °C and use within 24 h after preparation.

3. Egg Collection and Fertilization

1. Apply a very thin layer of vegetable shortening to a 20 cm diameter clean dry spawning pan.
2. Place the female in the anesthetic solution containing 100 ppm of buffered tricaine methane sulfonate with sodium bicarbonate (pH of final solution should be 7.0) until the fish is completely anesthetized³⁸.
   CAUTION: Tricaine methane sulfonate may be irritating if inhaled, ingested or absorbed through the skin.
3. Carefully, remove the fish from the spawning bag and dip it in 0.9% saline to wash off the anesthetic solution. Dry the fish off completely using a clean towel, avoiding the removal of the mucus layer on the fish body surface.
4. Apply vegetable shortening to the area around the vent, including the pelvic fins, to prevent attachment of the eggs during hand stripping.
5. Hand strip the eggs into the greased spawning pan by applying gentle pressure to the ovaries. Good eggs should flow freely, be golden yellow in color, and have minimal or no clumps or blood clots (Figure 2). Avoid contact between eggs and water before fertilization, as water can stimulate micropyle closure.
6. To fertilize the eggs for microinjection, transfer 200–300 eggs to a greased spawning pan. Greased plastic plant labels can be used as a spoon to transfer eggs to the greased spawning pan. Add 1–2 mL of the sperm solution (from step 2.5) to the eggs and mix gently. The ratio of sperm to egg should be approximately 11,000 sperm/egg.
7. Add freshwater to the eggs to activate the sperm and eggs. Add enough water to slightly cover the eggs. Gently swirl the eggs for 30 s. Fertilization should occur in 1–2 min. It is important to fertilize eggs which are arranged in a single layer. Catfish eggs adhere to each other making it difficult to microinject multiple layers of embryos.
8. Add more freshwater to the fertilized eggs and allow the eggs to harden for 10–15 min.
9. Cover the spawning pan containing the remaining unfertilized eggs by a wet towel to prevent drying and fertilize over a few hours. Fertilization can be done in a staggered manner, for example, one batch of 200–300 eggs can be fertilized every 30–60 min to ensure a continuous supply of embryos at the one cell stage for microinjection and control non-injected embryos. Avoid contact between the wet towel and the eggs as the eggs may adhere to the wet towel making it difficult to remove them. In this protocol, eggs fertilized within 2–3 h after stripping were efficiently microinjected and had similar success as eggs fertilized immediately after stripping.

4. Needle Pulling and Loading

1. Pull a 1.0 mm OD borosilicate glass capillary into 2 needles (Figure 3). Store the needles in a paper box with a piece of sponge in which several incisions have been made. To avoid breaking the needle, the diameter of the sponge should be smaller than the length of the needle stem.
2. Open the needle tip by breaking a small piece of the needle's thinnest region using a sharp object. Alternatively, open the needle by pinching off the thinnest region of the tip with forceps under the microscope.
3. Prepare the injection solution by mixing gRNA(s) with Cas9 protein. Other types of RNA or protein can also be injected with the same procedure. In this protocol, gRNAs were designed to target two of the channel catfish immune related genes, toll/interleukin 1 receptor domain-containing adapter molecule (TICAM1) gene and rhamnose binding lectin (RBL) gene and prepared according to Shah et al. with the use of a high fidelity Taq polymerase^32,39. The genomic targets for gRNAs were 5' GGA GGT GAA GCA CGT CGA GGA 3' for TICAM 1 gene (Figure 4) and 5' GGA CTT TGA GTC GGA GAA GTG G 3' for exon 1 of RBL gene with protospacer adjacent motif (PAM) sequence underlined (Figure 6).
   1. BLAST guide RNA targets against the channel catfish genome sequence and select those with no potential off-target sites.
   2. Add phenol red to color the gRNA/Cas9 protein mix up to one third of the total volume.
   3. Adjust the final concentration of gRNA/Cas9 protein mix with nuclease free water so that each embryo is injected with 50 nL containing approximately 2.5 ng gRNA and 7.5 ng Cas9 protein. Incubate the mixture for 10 min on ice before use.
4. With a microloader, load 5–10 µL of the gRNA/Cas9 mixture into the injection needle by inserting the microloader into the needle stem and expelling the mixture slowly while retracting the microloader tip (Figure 3). Avoid trapping air bubbles inside.
5. Attach the needle to the micropipette holder and ensure a tight connection, and then attach the holder to the micromanipulator. Ensure free stable movement. Apply pressure for microinjection by opening the nitrogen cylinder and adjusting the pressure regulator.
   NOTE: The volume of injection can be affected by the pressure, diameter of the needle aperture, and duration of injection. To determine the volume to inject, inject into a drop of mineral oil placed on a hemocytometer. If needed, the pressure, duration of injection, and needle diameter can be adjusted to increase or decrease the volume of the injection. Inject multiple times into the mineral oil to ensure consistent volume.

5. Microinjection of Catfish Embryos

1. Apply a very thin layer of vegetable shortening to a 100 mm clean Petri dish.
2. Using a greased plastic plant label, transfer 50–100 eggs from the fertilization pan to the Petri dish and cover them with Holtfreter's solution (Materials Table). Align the eggs against each other in a single layer. This alignment should hold the eggs in place during the microinjection process.
3. Place the Petri dish with the eggs on the stage of the microscope and hold it with one hand. Lower the needle with the other hand (Figure 3) until it pierces the chorion and the yolk in a single smooth movement. The tip of the needle should be as close as possible to the blastodisc before delivering the injection material.
   1. Depress the pedal to deliver the injection material into the yolk. If the blastodisc is not clearly visible, then the injection material can be spread into different locations in the yolk. To do that, the needle is inserted to the far end of the yolk, then depressing the pedal and withdrawing the needle are done simultaneously to spread the injection material through different areas of the yolk. Up to 50 nanoliters can be injected into the yolk of channel catfish embryos, however, the amount of gRNA/Cas9 protein needs to be optimized for each gene to achieve the best results for mutation rate and embryo survival³².
4. Retract the needle smoothly so as not to damage the egg. Move the Petri dish to inject another egg with the same procedure. Avoid movement of the Petri dish during the injection process as this may damage the egg or break the needle. Remove eggs that are ruptured or damaged due to microinjection. Injection can be started at 15–20 min after fertilization and continue as long as the embryos are still in the one cell stage (until about 60-90 min after fertilization).
5. Place injected embryos back in Holtfreter's solution with 10 ppm of doxycycline and continuous gentle aeration for 6–7 days until hatching⁴⁰. Change the solution daily and remove dead embryos.

6. Mutation Detection

1. Randomly, collect several injected embryos at 72 h post fertilization, remove the yolk and extract genomic DNA. Include 3–5 non-injected embryos as a control.
   NOTE: Genomic DNA can be extracted from embryos after removal of egg shells and yolk material using proteinase K digestion and ethanol precipitation³².
2. Amplify a DNA segment flanking the genomic targets for gRNA of each gene, where mutations are expected to occur, using a high fidelity Taq polymerase³². For TICAM 1, the primers 5'GCTGCTGAATGTCTGATTATG 3' (forward) and 5'GTCCTCCACACTCCTGAAG 3' (reverse) were used to amplify a 750 bp while for RBL, the primers 5'TCATTATTTCCTGGTACTCAGTA 3' (forward) and 5'AGAGATTAGTCACACATCATTATT 3' (reverse) were used to amplify a 375 bp segment from the RBL gene.
   1. Use the following PCR reaction: up to 20 µL PCR grade water; 1x high fidelity Taq enzyme reaction buffer with MgCl₂, 0.2 mM dNTP mix, 0.4 µM for each of the forward and reverse primer of the same set, 100-300 ng genomic DNA and 1.25 units of high fidelity Taq enzyme blend. Perform PCR cycling conditions: initial denaturation at 94 °C for 3 min; 35 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 55 s for TICAM, and 40 s for RBL, extension at 72 °C for 1 min/kb; and final extension at 72 °C for 10 min.
3. Detect the mutant embryos using a mutation detection method such as sequencing of purified PCR products, surveyor mutation detection assay, heteroduplex mobility assay, loss of restriction enzyme recognition site, or any other mutation detection method that is appropriate for the target. In this protocol, detect mutant embryos using surveyor mutation detection assay for TICAM 1 and loss of restriction enzyme SapI cut site as well as sequencing of purified PCR products for RBL gene.
4. To identify mutant alleles, clone PCR products and sequence vectors from individual colonies. The mutant alleles presented in Figure 4 and Figure 6 came from injected embryos. PCR products from six microinjected and 3 control embryos for each gene were pooled in two separate tubes, one for microinjected embryos and the other for control embryos, rapidly cloned and 86 vectors for TICAM 1 and 48 vectors for RBL gene sequenced, including 8 sequencing reactions from 3 control non-injected embryos for each gene.
5. To identify different mutant alleles, compare the sequences from mutant embryos to the wild type sequence using any DNA sequence alignment tool such as BLAST or T-COFFEE.