1. Amplification of the HIV-1 gag Gene from Infected, Frozen Plasma
2. Preparing gag Amplicons for Cloning by Introduction of the Necessary Restriction Sites
3. Cloning Amplified gag Genes into the MJ4, Subtype C, Infectious Molecular Clone
4. Generation and Titering of Replication Competent Gag-MJ4 Chimeric Viruses
5. Preparation of Culture Media and Propagation of GXR25 Cells for in vitro Replication Assay
6. In vitro Replication of Gag-MJ4 Chimeras in GXR25 (CEM-CCR5-GFP) Cells
7. Analysis of Reverse Transcriptase (RT) in Cell Culture Supernatants
Protocol adapted from Ostrowski et al40.
In order to properly execute this protocol, which creates a proviral plasmid capable of assembling fully functional, infectious Gag-MJ4 chimeras, great care must be taken to generate the appropriate PCR amplicons. Determining whether the PCR has generated the appropriately sized gag amplicon is crucial. Products should be within 100 base pairs (bp) of the approximately 1,700 bp amplicon depicted in Figure 1A. The exact length of this fragment will vary depending on the gag gene under study. Next, the 5’ long terminal repeat (LTR) portion of the MJ4 molecular clone must be amplified and spliced to the gag amplicon in order to make it suitable for subsequent cloning. The MJ4 LTR amplicon should be 1,474 bp in length. Figure 1B shows a representative gel image for which correct band sizes are indicated. After the splice-overlap-extension PCR41, combined LTR-gag products should be approximately 3,200 bp in length, as depicted in Figure 1C.
Once the gag gene has been made suitable for cloning by fusion to the 5’ LTR from MJ4, which contains the necessary NgoMIV restriction site, both vector and gag insert must be digested with NgoMIV and BclI restriction enzymes and excised from an agarose gel after electrophoretic separation. It is imperative to excise the appropriate vector and insert bands. A representative gel is shown in Figure 2. The vector portion of the MJ4 plasmid should be approximately 10,000 bp in length, while the LTR-gag insert should remain at approximately 3,000 bp in length, as the restriction sites are located at the extreme ends of the amplicon. Any significant decrease in size will indicate an additional cut-site within the gag gene under study.
Following ligation of the two fragments, bacterial transformation, and isolation of plasmid DNA, the Gag-MJ4 chimeras must be checked for appropriate size by performing a double digest with NgoMIV and HpaI restriction enzymes. Full-length Gag-MJ4 chimeras that have not incurred any deletion events during bacterial replication should have a restriction pattern similar to that depicted in Figure 3, with two bands of approximately 8,700 and 4,300 bp.
An important distinction of this protocol compared to previous approaches, is the use of the HIV-1 subtype C infectious molecular clone, MJ4, rather than the more common laboratory-adapted NL4-3 virus. However, the approaches described in the previous section could be modified for cloning of subtype B gag sequences into pNL4-3.
An optimization of the multiplicity of infection (MOI) for use in subsequent experiments was performed in order to select the ideal MOI that showed logarithmic growth of a majority of the viruses tested. Figure 4 depicts representative replication curves from three different MOIs (0.01, 0.05, and 0.25) for MJ4 (Figure 4A) as well as for NL4.3 (Figure 4B). MJ4 replicates much less efficiently in GXR25 cells than NL4-3, which is important to take into account, as an MOI appropriate for NL4-3 replication would likely be too low to detect efficient MJ4 replication. As seen in Figure 4A, an MOI of 0.05 as opposed to 0.01 or 0.25, was the ideal choice, because logarithmic growth was observed between days 2-6 for MJ4. For the lower MOI, 0.01, day 6 DLU values are barely detectable, and we anticipated the generation of Gag-MJ4 chimeric viruses that replicated lower than MJ4. Therefore this MOI would not capture the growth of the more attenuated Gag-MJ4 chimeras, which may also be the most biologically critical. Additionally, an MOI of 0.25 was not ideal, because the rapid kinetics of viral replication killed a substantial amount of cells even by day 4. This causes the replication curve to plateau, and calculating a slope based on a curve such as this would underestimate the replication capacity. Based on curves generated for NL4-3, even at an MOI of 0.01, available cell targets have been noticeably exhausted by day 6 post infection. In conclusion, an MOI of 0.05 was found to be optimal for a large panel of Gag-MJ4 chimeric viruses, all of which had diverse Gag sequences and varying degrees of replication.
A total of 149 Gag-MJ4 chimeric viruses derived from acute subtype C Gag sequences have been tested for in vitro replication using this assay. The normalized RC values ranged from 0.01 to over 3.5 with some viruses replicating more than 100 times more efficiently than wild-type MJ4. Figure 5 shows the replication curves from nine representative Gag-MJ4 chimeric viruses, with wild-type MJ4 depicted in red, and demonstrates the wide range of replication capacities observed. Thus, the sequence diversity within the gag gene alone can drastically impact the ability of the virus to replicate in vitro. While this is representative of Gag-MJ4 chimeric viruses derived from acutely infected Zambians, other subtype C sequences have not been extensively tested, and may exhibit different replication kinetics. Therefore, great care must be taken to optimize the MOI to suit the specific replication of the viruses of a particular study, because there can be a wide range in the levels of replication between different HIV-1 backbones and Gag isolates.
One of the advantages of using a T-cell line such as the GXR25 cell line, that supports the replication of MJ4, is the level of reproducibility observed relative to replication experiments using stimulated peripheral blood mononuclear cells as targets. In initial optimization experiments, MJ4 wild type exhibited an intra-assay variability of 8.7%, and different clones of the same Gag-MJ4 chimeric virus exhibited variability in replication of 8.5%. Because different master mixes and phosphoscreen exposures may give DLU values that differ slightly in magnitude, intra-assay variability can further be controlled by running the same virus standard (in our case wild-type MJ4) in each RT assay plate. Figure 6 graphs the DLU values derived from the same MJ4 infection, quantified in eight different RT plates. Normalizing to a virus that is common to all RT assays can help to mitigate potential error induced by these slight changes in signal magnitude between assays.
Inter-assay variably was also tested and replicates repeated on different days were highly correlated. Figure 7 plots the normalized RC score values from two independent experiments performed approximately one year apart. A high degree of correlation with the absence of major outliers (R2 = 0.873) was observed between the two independent replicates.
Although highly correlated, there is some variability in the overall magnitude of replication kinetics between the two independent experiments. This can be attributed in part to the difference in passage numbers between the GXR25 cells stocks used in each experiment. In general, GXR25 cells stocks that have been passaged for a period of time greater than 6 months tend to support more efficient replication of Gag-MJ4 chimeras. Therefore, it is advisable to assess replication capacity among groups of chimeras within a one-month time frame. When the previous steps are followed closely, this assay is capable of producing highly robust and reproducible results, which are applicable to a wide range of studies.
Figure 1. Representative gel images depicting electrophoretic separation of PCR products. For all PCR products, 5 µl of each 50 µl reaction was mixed with 3 µl of 5x loading dye, loaded into a 1% agarose-TAE gel supplemented with 1X SYBR-safe DNA gel stain, and separated by electrophoresis at 120 V for 45 min. The Promega 1 kb DNA ladder (Lane 1) was used to approximate amplicon sizes. A) The gag gene was amplified from viral RNA using a nested PCR approach. Due to insertions and deletions, the gag amplicon may vary from 1,600-1,700 bp in length and appears slightly above the 1,500 bp DNA ladder marker. Lanes 2-5 depict successful gag gene amplification. B) The 5’ LTR of MJ4 was amplified from the wild-type MJ4 plasmid and visualized via electrophoretic separation. Lanes 2-5 depict successful amplification of the 1,474 bp LTR product, which appears slightly below the 1,500 bp DNA ladder marker. C) The 5’ LTR derived from wild-type MJ4 and the gag gene amplified from patient plasma are fused together via splice-overlap-extension PCR and visualized via electrophoretic separation. Lanes 2-5 depict successfully fused amplicons that are approximately 3,200 bp in size, and which appear slightly above the 3,000 bp DNA ladder marker.
Figure 2. Representative gel image depicting electrophoretic separation of restriction digests for cloning patient gag genes into MJ4. Wild-type MJ4 plasmid and LTR-gag fusion products were digested with BclI for 1.5 hr at 50 °C and NgoMIV for 1 hr at 37 °C. Vector and insert fragments were visualized via electrophoretic separation on a 1% agarose-TAE gel supplemented with 1X SYBR-safe DNA gel stain at 100 V for 2 hr and using a blue light illuminator in order to reduce UV-induced DNA damage. The vector and insert fragments suitable for subsequent cloning steps appear at approximately 10,000 bp and 2,900 bp respectively.
Figure 3. Representative gel image depicting electrophoretic separation of restriction digests of purified Gag-MJ4 chimera plasmid DNA. Purified Gag-MJ4 chimera plasmid DNA was double-digested with NgoMIV and HpaI restriction enzymes for 2 hr at 37 °C. Restriction digests were visualized via electrophoretic separation on a 1% agarose-TAE gel supplemented with 1X SYBR-safe DNA gel stain at 120 V for 45 min. Plasmids without large deletions will resolve to two distinct bands at approximately 8,700 and 4,300 bp.
Figure 4. Replication of MJ4 and NL4-3 isolates of HIV-1 in the GXR25 cell line at different multiplicities of infection (MOI). 5 x 105 GXR25 cells were infected as described in the method protocol with 5-fold increasing MOI of each virus stock. Supernatants were collected on days 2, 4, 6, and 8 post infection and virion production was quantified via a radiolabeled reverse transcriptase assay. Infections were run in triplicate and error bars denote the standard deviation for the three replicates. (A) MJ4 (B) NL4-3.
Figure 5. Representative range of replication for different Gag-MJ4 chimeras. As described in the method protocol, 5 x 105 GXR25 cells were infected with wild-type MJ4 or Gag-MJ4 chimeras at an MOI of 0.05, supernatants were collected at two day intervals post infection, and virion production quantified by a radiolabeled RT assay. Insertion of various subtype C derived gag genes can have a dramatic impact on the replication capacity of MJ4. Wild-type MJ4 replication is denoted in red.
Figure 6. Comparison of intra-assay variation in the radiolabeled reverse transcriptase (RT) quantification assay. The graph depicts inherent intra-assay variability by plotting the DLU values of the same supernatants from a single wild-type MJ4 infection in eight different RT assay plates. The variation in curves reflects the slight changes in signal magnitude between plates, which can be corrected for by running a standard on each RT plate, which can be subsequently used to normalize the slopes of Gag-MJ4 chimeras assayed on the same plate.
Figure 7. Reproducibility of the replication assay over time in the GXR25 cell line. The same Gag-MJ4 chimeric viruses were used to infect GXR25 cells in two independent experiments performed approximately one year apart. Replication scores were generated by calculating the slope of log-transformed DLU values and normalizing that slope to wild-type MJ4. Gag-MJ4 chimeras that replicate more efficiently than wild-type MJ4 have replication scores greater than 1, and those that replicate less efficiently than wild-type MJ4 have replication scores less than 1. The two independent measurements are strongly correlated (R2 = 0.87, linear regression) and highlight the reproducibility of assays performed at different times and with cells at different passages.
A)
Reagent | Volume for 1x reaction (μl) |
2x Reaction Mix (Invitrogen) | 25 |
Nuclease-free H2O | 17 |
Forward primer GOF (20 μM concentration) | 1 |
Reverse primer VifOR (20 μM concentration) | 1 |
SuperScript III One-step Enzyme Mix | 1 |
RNA template | 5 |
Total volume | 50 |
B)
Number of Cycles | Time (hr:min:sec) | Temperature (°C) |
1 | 1:00:00 | 50 |
1 | 2:00 | 94 |
10 | 0:15 | 94 |
0:30 | 56 | |
5:00 | 68 | |
40 | 0:15 | 94 |
0:30 | 56 | |
5:00 + 5 sec/cycle | 68 | |
1 | 12:00 | 68 |
1 | ∞ | 4 |
END |
Table 1. A) Master mix and B) thermocycler conditions for first-round gag amplification. *Note: GOF primer sequence: 5'-ATTTGACTAGCGGAGGCTAGAA-3'. VifOR primer sequence: 5'-TTCTACGGAGACTCCATGACCC-3'.
A)
Reagent | Volume for 1x reaction (μl) |
Nuclease-free H2O | 35.5 |
5x Phusion HF Buffer | 10 |
dNTPs (40 mM deoxynucleotides) | 1 |
Forward primer GagInnerF1 (20 μM concentration) | 1 |
Reverse primer BclIDegRev2 (20 μM concentration) | 1 |
Phusion Hot Start II Polymerase | 0.5 |
First-round PCR as template | 1 |
Total volume | 50 |
B)
Number of Cycles | Time (hr:min:sec) | Temperature (°C) |
1 | 0:30 | 98 |
29 | 0:10 | 98 |
0:30 | 53 | |
1:00 | 72 | |
1 | 10:00 | 72 |
1 | ∞ | 4 |
END |
Table 2. A) Master mix and B) thermocycler conditions for nested second-round gag amplification. *Note: GagInnerF1 primer sequence: 5'-AGGCTAGAAGGAGAGAGATG-3'. BclIDegRev2 primer sequence: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3'.
A)
Reagent | Volume for 1x reaction (μl) |
Nuclease-free H2O | 35.5 |
5x Phusion HF Buffer | 10 |
dNTPs (40 mM deoxynucleotides) | 1 |
Forward primer MJ4For1b (20 μM concentration) | 1 |
Reverse primer MJ4Rev (20 μM concentration) | 1 |
Phusion Hot Start II Polymerase | 0.5 |
MJ4 plasmid as template (10 ng/ul) | 1 |
Total volume | 50 |
B)
Number of Cycles | Time (hr:min:sec) | Temperature (°C) |
1 | 0:30 | 98 |
29 | 0:10 | 98 |
0:30 | 58 | |
0:45 | 72 | |
1 | 10:00 | 72 |
1 | ∞ | 4 |
END |
Table 3. A) Master mix and B) thermocycler conditions for 5’ MJ4 LTR amplification. *Note: MJ4For1b primer sequence: 5'-CGAAATCGGCAAAATCCC-3'. MJ4Rev primer sequence: 5'-CCCATCTCTCTCCTTCTAGC-3'.
A)
Reagent | Volume for 1x reaction (μl) |
Nuclease-free H2O | 34.5 |
5x Phusion HF Buffer | 10 |
dNTPs (40 mM deoxynucleotides) | 1 |
Forward primer MJ4For1b (20 μM concentration) | 1 |
Reverse primer BclIRev (20 μM concentration) | 1 |
MJ4 LTR 1.3 kb amplicon (Gel purified, ~50 ng) | 1 |
Phusion Hot Start II Polymerase | 0.5 |
Gag amplicon (Gel purified, ~100 ng) | 1 |
Total volume | 50 |
B)
Number of Cycles | Time (hr:min:sec) | Temperature (°C) |
1 | 0:30 | 98 |
29 | 0:10 | 98 |
0:30 | 58 | |
1:30 | 72 | |
1 | 10:00 | 72 |
1 | ∞ | 4 |
END |
Table 4. A) Master mix and B) thermocycler conditions for splice-overlap-extension PCR to generate LTR-gag inserts. *Note: BclIRev primer sequence: 5'-TCTATAAGTATTTGATCATACTGTCTT-3'
A)
Reagent | Volume for 1x reaction (μl) | Incubation Time (hr) | Incubation Temperature (°C) |
1.5 μg of 3 kb LTR-gag amplicon or MJ4 plasmid | x μl for 1.5 μg | ||
NEB CutSmart Buffer (previously NEB Buffer #4) | 2 | ||
BclI restriction enzyme | 1 | ||
Nuclease-free H2O | x | ||
Total volume | 19 | 1.5 | 50 |
NgoMIV restriction enzyme | 1 | ||
Total volume | 20 | 1 | 37 |
B)
Reagent | Volume for 1x reaction (μl) | Incubation Time (hr) | Incubation Temperature (°C) |
50 ng cut MJ4 plasmid vector | x μl for 50 ng | ||
45 ng cut LTR-gag insert (3:1 ratio) | x μl for 45 ng | ||
Roche 10x ligase buffer | 2 | ||
Roche T4 DNA ligase (5 U/μl) | 1 | ||
Nuclease-free H2O | x | ||
Total volume | 20 | 18+ (overnight) | 4 |
C)
Reagent | Volume for 1x reaction (μl) | Incubation Time (hr) | Incubation Temperature (°C) |
450 ng of Gag-MJ4 plasmid | x μl for 450 ng | ||
NEB CutSmart Buffer (previously NEB Buffer #4) | 2 | ||
NgoMIV restriction enzyme | 0.5 | ||
HpaI restriction enzyme | 0.5 | ||
Nuclease-free H2O | x | ||
Total volume | 20 | 2 | 37 |
Table 5. A) Restriction digest master mix and B) ligation reaction for generation of Gag-MJ4 chimeric provirus. C) Diagnostic restriction digest to ensure Gag-MJ4 cloning fidelity.
Primer Name | Nucleotide Sequence (5' – 3') |
GagInnerF1 | AGGCTAGAAGGAGAGAGATG |
GagF2 | GGGACATCAAGCAGCCAT |
For3 | CTAGGAAAAAGGGCTGTTGGAAATG |
GagR6 | CTGTATCATCTGCTCCTG |
Rev3 | GACAGGGCTATACATTCTTACTAT |
Rev1 | AATTTTTCCAGCTCCCTGCTTGCCCA |
Table 6. List of sequencing primers necessary to confirm 5’ LTR and gag sequence identity of Gag-MJ4 chimeric provirus.
Well A | 8 µl virus + 232 µl 1% FBS in DMEM |
Well B | 80 µl from Well A + 160 µl 1% FBS in DMEM |
Well C | 80 µl from Well B + 160 µl 1% FBS in DMEM |
Well D | 80 µl from Well C + 160 µl 1% FBS in DMEM |
Well E | 80 µl from Well D + 160 µl 1% FBS in DMEM |
Well F | 80 µl from Well E + 160 µl 1% FBS in DMEM |
Table 7. Dilution scheme (3-fold) for titering infectious viruses on TZM-bl cells.
A)
Reagent | Volume |
PBS without Ca2+ or Mg2+ | 500 ml |
Gluteraldehyde | 4 ml |
Formaldehyde | 11 ml |
*Note: Store at 4 °C.
B)
Reagent | Volume |
PBS without Ca2+ or Mg2+ | 4.75 ml |
Potassium ferricyanide (0.2 M) | 100 μl |
Potassium ferrocyanide (0.2 M) | 100 μl |
Magnesium chloride (1 M) | 20 μl |
X-gal (50 mg/ml) | 40 μl |
*Note: Make fresh and store away from light until use.
C.
Original Dilution well | A | B | C | D | E | F |
Volume of virus (µl) added to the wells of a 24-well plate row | 5 | 1.6667 | 0.5556 | 0.1852 | 0.06173 | 0.02057 |
Table 8. A) Staining and B) fixing solutions for titering of Gag-MJ4 chimeric viruses on the TZM-bl indicator cell line. C) The volume of virus added per well for calculating infectious units/µl.
Reagent | Volume |
Fetal bovine serum (FBS), defined | 55 ml |
Penicillin, Streptomycin, Glutamine (100x) | 6 ml |
HEPES buffer (1 M) | 6 ml |
Table 9. Recipe for complete RPMI medium for propagation of GXR25 cells.
Reagent | Volume (ml) |
Nuclease-free H2O | 419.5 |
Tris-Cl, pH 7.8 (1 M) | 30 |
Potassium chloride (1 M) | 37.5 |
Magnesium chloride (1 M) | 2.5 |
Nonidet P-40 (10%) | 5 |
EDTA (0.5 M) | 1.02 |
Polyadenylic acid, potassium salt (2 mg/ml) | 1.25 |
Oligo-dT primer (25 μg/ml) | 3.25 |
Total volume | 500 |
Table 10. Recipe for radiolabeled reverse-transcriptase assay master mix. *Note: Store as 1 ml aliquots at -20 °C.
Name of the Reagent | Company | Catalogue number | Comments |
PCR reagents | |||
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
CoolRack PCR 96 XT | Biocision | BCS-529 | |
CoolRack M15 | Biocision | BCS-125 | |
Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
PCR Nucleotide Mix | Roche | 4638956001 | |
Agarose, high gel strength | Fisher | 50-213-128 | |
TAE 10X | Life Technologies/Invitrogen | AM9869 | |
Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
Thermocycler, PTC-200 | MJ Research | ||
Microbiology & Cloning reagents | |||
LB Agar, Miller | Fisher | BP1425-2 | |
LB Broth, Lennox | Fisher | BP1427-2 | |
Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
BclI restriction endonuclease | New England BioLabs | R0160L | |
HpaI restriction endonuclease | New England BioLabs | R0105L | |
T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
PureYield plasmid miniprep system | Promega | A1222 | |
Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
Cell culture reagents | |||
Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
DEAE-Dextran | Fisher | NC9691007 | |
Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
FBS, Defined, 500 ml | Fisher | SH30070 03 | |
X-gal | VWR | PAV3941 | Manufactured by Promega |
Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
TC10 automated cell counter | Bio-Rad | 1450001 | |
VistaVision inverted microscope | VWR | ||
Reverse-Transcriptase Quantification Assay reagents | |||
dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
Nonidet P40 | Roche | 11333941103 | |
Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
DE-81 anion exchange paper | Whatman | 3658-915 | |
Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
Sodium Chloride | Fisher | S671-3 | |
Autoradiography cassette | Fisher | FB-CA-810 | |
Cyclone storage phoshpor screen | Packard |
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.