Summary

절연, 전파, 그리고 인간의 치과 펄프의 줄기 세포의 신경 분화 동안 프리온 단백질 표정

Published: March 18, 2019
doi:

Summary

여기 우리는 프리온 단백질 표정 신경 분화 과정을 평가 하기 위해 인간의 치과 펄프의 줄기 세포 분리 및 전파에 대 한 프로토콜을 제시.

Abstract

Bioethical 문제점 배아 줄기 세포의 조작에 관련 된 의료 연구의 분야에서 발전을 방해 있다. 이러한 이유로, 혈액, 골 수, 탯 줄, 지방 같은 다른 조직에서 성체 줄기 세포를 얻기 위해 매우 중요 하다. 가능한 소스 중 치과 펄프 이므로 특히 흥미로운 bioethical 고려 사항에 대 한 얻을 쉽습니다. 실제로, 인간 치과 펄프 줄기 세포 (hDPSCs) 같은 신경 세포에서 분화 할 수 성인 줄기 세포의 종류와 건강 한 환자 (13-19 세)의 세 번째 어 금 니에서 얻어질 수 있다. 특히, 치과 펄프 굴 삭 기 제거, 작은 조각으로 잘라, 콜라 4로 치료 되었고 플라스 크에서 경작. 신경 감 별 법을 유도, hDPSCs는 2 주 동안 EGF/bFGF와 자극 했다. 이전에 우리는 분화 과정에서 세포 프리온의 내용을 hDPSCs에서 단백질 (PrPC) 증가 증명 하고있다. Cytofluorimetric 분석 PrPC 신경 감 별 법 과정 후 증가의 초기 표현을 했다. SiRNA로 PrPC 의 절제 PrP EGF/bFGF에 의해 유도 된 신경 감 별 법을 방지. 이 문서에 우리 우리 향상 격리, 분리 및 여러 쉬운 절차를 가진 hDPSCs의 재배 방법을 생체 외에서 보다 효율적인 세포 클론 했다 중간 엽 줄기 세포 (MSCs)의 획득 및 대규모 확장 설명 관찰 되었다. 우리는 또한 어떻게는 프로토콜에 대 한 자세한 방법으로 얻은 hDPSCs는 MSCs의 신경 분화 과정과 후속 세포질과 분자 과정을 공부 하는 우수한 실험 모델을 보여줍니다.

Introduction

중간 엽 줄기 세포는 골 수, 탯 줄 혈액, 인간의 치과 펄프, 지방 조직, 그리고 혈액1,2,3,,45 를 포함 하 여 여러 조직에서 고립 되어 있다 , 6. 여러 저자에 의해 보고, hDPSCs 표시 플라스틱 준수, 전형적인 구와 같은 형태학. 이러한 개별 복제와 증식 및 차별화 용량7,8차이 매우 이질적인 인구를 나타냅니다. hDPSCs 익스프레스 중간 엽 줄기 세포 (CD44, CD90, CD73, CD105, STRO-1)에 대 한 특정 마커, 그들은 일부 조 혈 마커 (CD14 CD19 등)에 대 한 부정적인 고 생체 외에서 multilineage 차별화9, 10,11.

몇몇 저자가이 세포는 NGF, bFGF, 특정 미디어 및 보충7,12와 함께에서 EGF의 추가 포함 하는 다른 프로토콜을 사용 하 여 같은 신경 세포로 분화 할 수 나타났습니다. 또한, 많은 단백질 신경 분화 과정에 참여 하 고,이 중, 여러 논문 표시 모두 배아와 성체 줄기 세포13, 관련 역할 및 세포 프리온 단백질 (PrPC)의 중요 한 표현 14. PrPC 나타냅니다 구리 물질 대사, apoptosis로 셀 안에 서로 다른 기능을 수행할 수 있는 다 면 발현 성 분자 그리고 저항을 산화 스트레스15,,1617 , 18 , 19 , 20 , 21 , 22.

우리의 이전 종이23, 우리는 PrPC hDPSCs 신경 분화 과정에서의 역할을 조사. 사실, hDPSCs 익스프레스 PrPC 조 하 고, 신경 감 별 법 후 추가 증가 관찰 하는 것이 가능 했다. 다른 저자는 PrPC 줄기 세포의 신경 분화 과정에서의 가능한 역할을 가정 했다. 실제로, PrPC 신경, oligodendrocytes, 및 이다24에 인간 배아 줄기 세포의 분화를 드라이브. 이 연구의 목적은 신경 감 별 법 동안 치과 펄프, 그것의 분화 과정과 PrPC 의 역할에서 줄기 세포를 얻기 위한 방법론을 강조 했다.

Protocol

연구에 사용 하는 세 번째 어 금 니 환자 (13-19 세)의 약물 또는 알코올 소비 이전 역사 없이, 모든 비 흡연와 적절 한 구강 위생에서에서 excised 했다. 설명 과학 치과와 로마의 “역사적인” 대학 Maxillofacial 당일 동의 환자 또는 부모에서 얻은 했다. 동의 윤리적 고려 사항 및 윤리 위원회의 승인에 따라 얻은 했다. 1. 치아 및 치과 펄프 추출 보존 또는 교통에 대 한 적…

Representative Results

세 번째 모 랄에서 얻은 치과 펄프에서 hDPSCs의 격리 및 분리 절차는 작은 변화 파괴적인 결과 발생할 수 있는 복잡 한 프로세스. 이 문서에서 사용 하는 프로토콜의 아서 외. 12 여러 가지 개선입니다. 절차의 대표적인 구조는 그림 1에 표시 됩니다. hDPSCs 셀 별개 복제와 증식 및 차?…

Discussion

이 작품에서는, 우리가 격리와 hDPSCs;의 신경 분화에 대 한 방법론에 초점을 맞춘 또한, 우리는이 과정에서 PrPC 의 역할 평가. 분리 과정에서 신경 세포와 같은 세포에 중요 한 단계는 hDPSCs를 차별화 하는 여러 방법이 있다. hDPSCs는 chondroblasts, adipocytes, osteoblasts, 신경 등 여러 계보에서 차별화 수 있습니다. 우리 신문, 우리 신경 감 별 법의 메커니즘 및 PrPC의 존재를 조사. 위에서 설명…

Offenlegungen

The authors have nothing to disclose.

Acknowledgements

이 작품은 “피코 Varrone” 및 티 대학 허브 “사비 나 Universitas” 빈첸초 Mattei에 의해 지원 되었다.

그림 5 (A, B) 테일러 & 프랜시스 회사에서 게시자의 허가 reprinted: 역할의 프리온 단백질-EGFR multimolecular 복잡 한 인간의 치과 펄프 파생 된 줄기 세포의 신경 분화 하는 동안. Martellucci, S., Manganelli V. Santacroce C., Santilli F., 자녀 가족 L., Sorice M., Mattei V. 프리온. 3 월 4 2018입니다. 테일러 & 프랜시스

Materials

Amphotericin B solution Sigma-Aldrich A2942 It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce
Anti-B3tubulin Cell Signaling Technology  #4466 One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system
Anti-CD105  BD Biosciences 611314 Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail
Anti-CD44 Millipore CBL154-20ul Positive cell markers antibodies directed against mesenchymal stem cells
Anti-CD73  Cell Signaling Technology  13160 CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides
Anti-CD90 Millipore CBL415-20ul Positive cell markers antibodies directed against mesenchymal stem cells
Anti-GAP43  Cell Signaling Technology  #8945 Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity
Anti-mouse PE  Abcam ab7003 Is an antibody used in in flow cytometry or FACS analysis
Anti-NFH  Cell Signaling Technology  #2836 Is an antibody that detects endogenous levels of total Neurofilament-H protein
Anti-PrP mAb EP1802Y  Abcam ab52604 Rabbit monoclonal [EP 1802Y] to Prion protein PrP
Anti-rabbit CY5  Abcam ab6564 Is an antibody used in in flow cytometry or FACS analysis
Anti-STRO 1 Millipore MAB4315-20ul Positive cell markers antibodies directed against mesenchymal stem cells
B27 Supp XF CTS Gibco by life technologies A14867-01 B-27  can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture
BD Accuri C6 flow cytometer  BD Biosciences AC6531180187 Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm)
BD Accuri C6 Software  BD Biosciences Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results
bFGF PeproThec, DBA 100-18B basic Fibroblast Growth Factor 
Centrifuge CL30R Termo fisher Scientific 11210908 it is a device that is used for the separation of fluids,gas or liquid, based on density
CO2 Incubator 3541 Termo fisher Scientific 317527-185 it ensures optimal and reproducible growth conditions for cell cultures
Collagenase, type IV  Life Technologies 17104019 Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen
Disposable scalpel  Swann-Morton 501 It is use to cut tissues
DMEM-L Euroclone ECM0060L Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate
EGF PeproThec, DBA AF-100-15 Epidermal Growth Factor 
Fetal Bovine Serum Gibco by life technologies 10270-106 FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems
Filtropur BT50 0.2,500ml Bottle top filter Sarstedt 831,823,101 it is a device that is used for filtration of solutions
Flexitube GeneSolution for PRNP Qiagen GS5621 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA  N.2 CAGCAAATAACCATTGGTTAA  N.3. CTGAATCGTTTCATGTAAGAA  N.4  CAGTGACTATGAGGACCGTTA
Hank's solution 1x Gibco by life technologies 240200083 The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells
HiPerFect Transfection Reagent  Qiagen 301705 HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations
Neurobasal A  Gibco by life technologies 10888022 Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons 
Paraformaldehyde Sigma-Aldrich 30525-89-4 Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures
penicillin/streptomycin  Euroclone ECB3001D  It is use to supplement cell culture media to control bacterial contamination
Phosphate buffered saline  (PBS) Euroclone ECB4004LX10  PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range
TC-Platte 6 well, Cell+,F Sarstedt 833,920,300 It is a growth surface for adherent cells
Tissue culture flask T-25,Cell+,Vented Cap Sarstedt 833,910,302 Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag
Triton X-100  Sigma-Aldrich 9002-93-1 Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions
Trypsin-EDTA  Euroclone ECB3052D  Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface
Tube Sarstedt 62,554,502 Tube 15ml, 120x17mm, PP
VBH 36 C2 Compact Steril ST-003009000 Offers totally protection for the enviroment and worker
ZEISS Axio Vert.A1 – Inverted Microscope Zeiss 3849000962 ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods.

Referenzen

  1. Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
  2. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
  3. Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
  4. Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
  5. Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
  6. Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
  7. Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
  8. Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
  9. Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
  10. Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
  11. Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
  12. Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
  13. Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
  14. Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
  15. Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
  16. Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
  17. Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
  18. Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
  19. Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
  20. Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
  21. Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
  22. Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
  23. Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
  24. Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
  25. Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
  26. Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
  27. Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).

Play Video

Diesen Artikel zitieren
Martellucci, S., Santacroce, C., Manganelli, V., Santilli, F., Piccoli, L., Cassetta, M., Misasi, R., Sorice, M., Mattei, V. Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells. J. Vis. Exp. (145), e59282, doi:10.3791/59282 (2019).

View Video