Isolatie, vermeerdering en Prion eiwituitdrukking tijdens neuronale differentiatie van stamcellen van menselijke tandmerg
Summary
Hier presenteren we een protocol voor menselijke tandheelkundige Pulp stamcellen isolatie en vermeerdering teneinde het prion-eiwit expressie tijdens neuronale differentiatie.
Abstract
Bio-ethische kwesties in verband met de manipulatie van embryonale stamcellen hebben belemmerd vooruitgang op het gebied van medisch onderzoek. Om deze reden is het zeer belangrijk voor het verkrijgen van volwassen stamcellen uit verschillende weefsels zoals adipeus, bloed, navelstrengbloed en beenmerg. Onder de mogelijke bronnen is tandmerg bijzonder interessant omdat het is gemakkelijk te verkrijgen met betrekking tot bio-ethische overwegingen. Inderdaad, menselijke tandheelkundige Pulp stamcellen (hDPSCs) zijn een soort van volwassen stamcellen kunnen onderscheiden in neuronale-achtige cellen en kan worden verkregen bij de derde Kies voor gezonde patiënten (13-19 leeftijden). In het bijzonder werd het tandmerg verwijderd met een graafmachine, snijd in kleine plakjes, behandeld met collagenase IV en gekweekt in een maatkolf. Om de neuronale differentiatie, werden hDPSCs gestimuleerd met EGF/bFGF voor 2 weken. Eerder, hebben wij aangetoond dat tijdens de differentiatie wordt de inhoud van cellulaire prion eiwit (PrPC) in hDPSCs verhoogd. De cytofluorimetric-analyse toonde een vroege uiting van PrPC dat na het proces van de neuronale differentiatie is toegenomen. Ablatie van PrPC door siRNA PrP voorkomen neuronale differentiatie geïnduceerd door EGF/bFGF. In deze paper illustreren we dat als we het isolement, de scheiding en de in vitro cultivatie-methoden van hDPSCs met verschillende eenvoudige procedures versterkt, efficiënter cel klonen verkregen en grootschalige uitbreiding van de mesenchymale stamcellen (MSCs werden) werd waargenomen. Ook laten we zien hoe de hDPSCs, verkregen met methoden die zijn beschreven in het protocol, zijn een uitstekend experimenteel model om het proces van de neuronale differentiatie van MSCs en latere cellulaire en moleculaire processen te studeren.
Introduction
Mesenchymale stamcellen zijn geïsoleerd uit verschillende weefsels, met inbegrip van het beenmerg, navelstrengbloed, menselijke tandmerg, adipeus weefsel en bloed1,2,3,4,5 , 6. zoals gemeld door verschillende auteurs, hDPSCs kunststof hechting, een typische morfologie van de fibroblast-achtige Toon. Deze vertegenwoordigen een zeer heterogene populatie met verschillende klonen en verschillen in proliferatieve en onderscheidende capaciteit7,8. hDPSCs express specifieke markers voor mesenchymale stamcellen (d.w.z. CD44 CD90, CD73, CD105, STRO-1), ze zijn negatief voor sommige hematopoietische gegevensmarkeringen (bijvoorbeeld in CD14 en CD19) en zijn geschikt voor in-vitro differentiatie van de multilineage9, 10,11.
Verschillende auteurs hebben aangetoond dat deze cellen zijn bekwaam om te onderscheiden in neuron-achtige cellen met behulp van verschillende protocollen, waaronder de toevoeging van de NGF, bFGF, EGF in combinatie met de specifieke media en supplementen7,12. Ook veel eiwitten zijn betrokken neuronale differentiatie tijdens, en daaronder verscheidene papers Toon een relevante rol en aanzienlijke expressie van cellulaire prion-eiwit PrP (C), beide in embryonale en volwassen stamcellen13, 14. PrPC vertegenwoordigt een pleiotropic molecuul staat van het uitvoeren van verschillende functies binnen cellen als koper metabolisme, apoptosis, en weerstand tegen oxidatieve stress15,16,17 , 18 , 19 , 20 , 21 , 22.
We onderzochten in onze eerdere papier23, de rol van PrPC in het proces van de neuronale differentiatie hDPSCs. In feite, hDPSCs express precociously PrPC en, na de neuronale differentiatie, was het mogelijk om een extra verhoging van observeren. Andere auteurs hypothetische een mogelijke rol van PrPC in processen van de neuronale differentiatie van stamcellen. Inderdaad, PrPC drijft de differentiatie van menselijke embryonale stamcellen in neuronen, oligodendrocyten en de astrocyten24. Het doel van deze studie was om te benadrukken de methodologie voor het verkrijgen van stamcellen van tandmerg, zijn differentiatie-proces en de rol van PrPC tijdens neuronale differentiatie.
Protocol
Representative Results
Discussion
In dit werk, we gericht op methodologie voor isolatie en neuronale differentiatie van hDPSCs; we geëvalueerd bovendien de rol van PrPC in dit proces. Er zijn verschillende methoden om te isoleren en hDPSCs in neuron-achtige cellen en kritische stappen onderscheiden tijdens het proces. hDPSCs zijn bekwaam om te onderscheiden in verschillende geslachten zoals chondroblasts, adipocytes, botcellen en neuronen. In onze papier onderzochten we de mechanismen voor Neuronale Differentiatie en de aanwezigheid van PrP<s…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
Dit werk werd gesteund door de “Fondazione Varrone” en Rieti Universiteit Hub “Sabina Universitas” aan Vincenzo Mattei.
Figuur 5 (A, B) herdrukt met toestemming van de uitgever, Taylor & Francis Ltd uit: rol van Prion-eiwit-EGFR multimolecular complex tijdens neuronale differentiatie van menselijke tandheelkundige pulp-afgeleide cellen van de stam. Martellucci, S., Manganelli V., Santacroce C. Santilli F. Piccoli L., Sorice M., Mattei V. Prion. 2018 Mar 4. Taylor & Francis Ltd.
Materials
| Amphotericin B solution | Sigma-Aldrich | A2942 | It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce |
| Anti-B3tubulin | Cell Signaling Technology | #4466 | One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system |
| Anti-CD105 | BD Biosciences | 611314 | Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail |
| Anti-CD44 | Millipore | CBL154-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-CD73 | Cell Signaling Technology | 13160 | CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides |
| Anti-CD90 | Millipore | CBL415-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| Anti-GAP43 | Cell Signaling Technology | #8945 | Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity |
| Anti-mouse PE | Abcam | ab7003 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-NFH | Cell Signaling Technology | #2836 | Is an antibody that detects endogenous levels of total Neurofilament-H protein |
| Anti-PrP mAb EP1802Y | Abcam | ab52604 | Rabbit monoclonal [EP 1802Y] to Prion protein PrP |
| Anti-rabbit CY5 | Abcam | ab6564 | Is an antibody used in in flow cytometry or FACS analysis |
| Anti-STRO 1 | Millipore | MAB4315-20ul | Positive cell markers antibodies directed against mesenchymal stem cells |
| B27 Supp XF CTS | Gibco by life technologies | A14867-01 | B-27 can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture |
| BD Accuri C6 flow cytometer | BD Biosciences | AC6531180187 | Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm) |
| BD Accuri C6 Software | BD Biosciences | Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results | |
| bFGF | PeproThec, DBA | 100-18B | basic Fibroblast Growth Factor |
| Centrifuge CL30R | Termo fisher Scientific | 11210908 | it is a device that is used for the separation of fluids,gas or liquid, based on density |
| CO2 Incubator 3541 | Termo fisher Scientific | 317527-185 | it ensures optimal and reproducible growth conditions for cell cultures |
| Collagenase, type IV | Life Technologies | 17104019 | Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen |
| Disposable scalpel | Swann-Morton | 501 | It is use to cut tissues |
| DMEM-L | Euroclone | ECM0060L | Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate |
| EGF | PeproThec, DBA | AF-100-15 | Epidermal Growth Factor |
| Fetal Bovine Serum | Gibco by life technologies | 10270-106 | FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems |
| Filtropur BT50 0.2,500ml Bottle top filter | Sarstedt | 831,823,101 | it is a device that is used for filtration of solutions |
| Flexitube GeneSolution for PRNP | Qiagen | GS5621 | 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA N.2 CAGCAAATAACCATTGGTTAA N.3. CTGAATCGTTTCATGTAAGAA N.4 CAGTGACTATGAGGACCGTTA |
| Hank's solution 1x | Gibco by life technologies | 240200083 | The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells |
| HiPerFect Transfection Reagent | Qiagen | 301705 | HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations |
| Neurobasal A | Gibco by life technologies | 10888022 | Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons |
| Paraformaldehyde | Sigma-Aldrich | 30525-89-4 | Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures |
| penicillin/streptomycin | Euroclone | ECB3001D | It is use to supplement cell culture media to control bacterial contamination |
| Phosphate buffered saline (PBS) | Euroclone | ECB4004LX10 | PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range |
| TC-Platte 6 well, Cell+,F | Sarstedt | 833,920,300 | It is a growth surface for adherent cells |
| Tissue culture flask T-25,Cell+,Vented Cap | Sarstedt | 833,910,302 | Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag |
| Triton X-100 | Sigma-Aldrich | 9002-93-1 | Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions |
| Trypsin-EDTA | Euroclone | ECB3052D | Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface |
| Tube | Sarstedt | 62,554,502 | Tube 15ml, 120x17mm, PP |
| VBH 36 C2 Compact | Steril | ST-003009000 | Offers totally protection for the enviroment and worker |
| ZEISS Axio Vert.A1 – Inverted Microscope | Zeiss | 3849000962 | ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods. |
Referenzen
- Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
- Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
- Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
- Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
- Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
- Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
- Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
- Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
- Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
- Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
- Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
- Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
- Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
- Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
- Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
- Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
- Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
- Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
- Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
- Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
- Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
- Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
- Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
- Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
- Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
- Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).
