Tension Gauge Tether Probes for Quantifying Growth Factor Mediated Integrin Mechanics and Adhesion

1. TGT oligonucleotide preparation

NOTE: The details of oligonucleotide probe synthesis are outlined here. Please note some modifications and purification steps can be outsourced for custom synthesis.

1. Activate the primary amine of the cyclo[Arg-Gly-Asp-D-Phe-Lys(PEG-PEG)] peptide with the azide-NHS linker as described by Zhang et al²² by mixing in a 1:1.5 ratio (100:150 nmoles) in a final volume of 10 µL dimethylformamide. Add 0.1 µL of the organic base triethylamine and incubate for 12 h at 4° C.
2. Purify the product by reverse phase HPLC using 0.1 M TEAA (solvent A) and 100% acetonitrile (solvent B) with a flow rate of 1mL/ min and the initial condition of 10% solvent B set at a gradient of 0.5%/min. Combine the eluted peaks (absorbance at 203 nm) and verify by MALDI-TOF mass spectrometry. The product is cRGDfK-azide.
3. To generate the TGT top strand, combine cRGDfK-azide and alkyne-21-BHQ2 oligonucleotide (TGT top strand: 5Hexynyl/GTGAAATACCGCACAGATGCG/3BHQ_2) in a 2:1 ratio (῀200 µM: 100 µM) in 100 µL of 1x Phosphate Buffered Saline (PBS) with 5 mM sodium ascorbate and 0.1 µM preformed Cu-THPTA. Allow the reaction to proceed for a minimum of 4 h at room temperature (RT) or overnight at 4 °C.
4. Process the mixture through the P2 desalting gel to remove excess dye, by-products, organic solvent, and unreacted reagents. Prepare the centrifuge column with 650 µL of pre-hydrated P2 gel by spinning it down at 18,000 x g for 1 min. Discard the flow-through liquid and add the reaction mixture. Spin again at 18,000 x g for 1 min and collect the flow-through. Bring the reaction mixture to a final volume of 300 µL with ultrapure water.
   NOTE: Pre-hydrate the P2 gel with water for 6 h.
5. Purify the desalted reaction mixture by reverse-phase HPLC. The organic solvents used for this purification include 0.1 M TEAA in H₂O (solvent A) and 100% MeCN (solvent B, or the mobile phase).
   1. Prior to injecting the mixture, equilibrate the column with an initial condition of 10% Solvent B with a gradient of 1%/min. Adjust the flow rate to 1 mL/min. Inject the reaction mixture into the HPLC loop with a 500 µL injection needle.
   2. Collect the product by visualizing the peak absorption at 260 nm for the DNA and 560 nm for the BHQ2 quencher. Dry the eluted product overnight in a vacuum centrifugal concentrator.
6. Employ nucleophilic substitution to couple TGT bottom strand to Cy3B-NHS ester as described in Ma et. al²⁵. Mix 100 µM of the 56 pN TGT bottom strand (5Biosg/TTTTTT/iUniAmM/CGCATCTGTGCGGTATTTCACTTT) with 50 µg of Cy3B-NHS ester pre-dissolved in 10 µL of DMSO. Adjust the pH of this mixture to 9 with 0.1 M sodium bicarbonate and bring the final volume to 100 µL with 1x PBS. Incubate the reaction mixture overnight at RT.
7. Purify the mixture sequentially using P2 gel filtration and reverse-phase HPLC to separate unreacted reagents, salts, and organic solvents (described in steps 1.4 and 1.5).
8. Estimate the concentration of the purified oligonucleotide-dye conjugates by recording their absorbance at 260 nm using a spectrophotometer.
9. Characterize the purified products by MALDI-TOF mass spectrometry. Dissolve excess 3-hydroxypicolinic acid into TA50 solvent (50:50 v/v acetonitrile and 0.1% TFA in ddH₂O) to prepare the fresh MALDI matrix. Estimated and measured molecular weights for the labeled products are: cRGDfK-1-BHQ2 – 8157.9 (calculated), 8160.1 (found); Cy3B labeled 56 pN TGT – 10272.7 (calculated), 10295.8 (found).
10. Dissolve the top and the bottom strands separately in nuclease-free water at a concentration between 30-50 µM. Use DNase-free pipette tips to avoid stock contamination. Store at 4 °C for short-term applications or -20 °C for long-term applications. The stability of oligonucleotides is not affected by repeated freeze-thaw cycles.

2. Surface preparation

Day 1:

1. Place 25 mm glass coverslips (up to 8) into a polytetrafluoroethylene rack. Place the rack in a 50 mL borosilicate beaker containing 40 mL of 200 proof ethanol. Cover the beaker with paraffin film to avoid water from entering and sonicate at an operating frequency of 35 kHz for 10-15 min at RT (Figure 1A).
2. Fill a 50 mL beaker with 40 mL of Piranha solution freshly prepared by mixing sulfuric acid and hydrogen peroxide in a 3:1 ratio in a pyrex beaker. Stir with a glass pipette. Transfer the coverslip rack into the beaker and incubate for 30 min at RT in the fume hood to etch the coverslip surface (Figure 1B).
   NOTE: Wear full PPE, including a lab coat, gloves, and goggles, and work in the chemical fume hood. Add hydrogen peroxide to the acid slowly to prevent overheating of the solution.
3. After etching, use tweezers to transfer the coverslip rack to a beaker with ultrapure water. Repeat this step six times at 15 s intervals to completely neutralize the acid (Figure 1C).
   NOTE: Leave the Piranha solution in the chemical fume hood overnight before discarding it into the acid waste container.
4. Visually inspect the coverslips to ensure the surfaces look clean with no patterns or dust particles on the glass surface. Repeat steps 2.1-2.4 if patterns or dust are detected.
   NOTE: Test surface hydrophilicity by dipping treated coverslips in water and removing them vertically. Water on treated coverslips recedes as a uniform sheet to form Young's rings compared to untreated coverslips that form patches.
5. Transfer the coverslip rack to a beaker with 200 proof ethanol and wash twice for 15 s to equilibrate surfaces to organic solvent. Transfer the coverslip rack into 200 proof ethanol solution with 3% APTES for 1 h at RT to silanize the coverslips (Figure 1D). Cover the beaker with paraffin film.
   NOTE: APTES deposition parameters vary depending on the surface cleaning method, solvent water content, APTES concentration, incubation times, and temperature for annealing.
6. Immerse the rack in a clean beaker with 200 proof ethanol solution. Repeat this wash three times for 15 s each (Figure 1E).
7. Dry the coverslips using nitrogen (N₂) gas with low exit pressure. Place the coverslips into a 10 cm polystyrene dish with a piece of paraffin film laid flat inside it. Ensure the coverslips are dry and separated (Figure 1F).
8. Add 100 µL of 2 mg/mL NHS-biotin solution in DMSO to four coverslips placed on paraffin film. Set a "sandwich" with the other four coverslips on top (two coverslips facing toward each other with the functionalization solution in between) and incubate the dish overnight at 4 °C (Figure 1G).
   NOTE: At 4 °C, the NHS reagent is more stable, which facilitates uniform surface functionalization. Additionally, the sandwich conserves reagents. Avoid adding excess solution in the sandwich as it may leak out and cause coverslips to slip.

Day 2:

9. Remove the dish from 4 °C and separate the sandwiched coverslips. Orient the slips in the rack with the coated surface facing each other as shown in Figure 2A. Wash them with 200 proof ethanol solution three times for 15 s each. Dry with N₂ gas and place them in a new dish with a paraffin film inside it.
   NOTE: Orienting the coverslips as indicated helps identify the functionalized surface.
10. Wash the coverslips with 1 mL of 1x PBS three times to equilibrate them back to the aqueous phase. Add 800 µL of 0.1% bovine serum albumin (BSA) in 1x PBS (w/v) to each of the coverslips and incubate at RT for 30 min to passivate the surface and block non-specific binding of subsequent functionalization reagents (Figure 2B).
11. After incubation, wash the coverslips three times with 1 mL of 1x PBS. Add 800 µL of 1 µg/mL of streptavidin in 1x PBS at RT for 45-60 min to functionalize the coverslips (Figure 2C).
    NOTE: Retain one coverslip without streptavidin to verify passivation efficiency (optional). Add10 nM biotinylated molecules and image using experimental conditions. This surface intensity should be close to the camera's dark noise.
12. Simultaneously with step 2.11, assemble the TGT probes (top: bottom strand at 1:1 molar ratio) at a final concentration of 50 nM in 100 µL of 1 M NaCl in a PCR tube using a thermocycler. Dissociate strands at 95 °C for 5 min, and gradually anneal by reducing the temperature to 25 °C and maintaining it for 25 min (Figure 2D). Avoid extended exposure of TGT probes to light.
13. After streptavidin incubation, use 1x PBS to wash the coverslips three times. Add 100 µL of the pre-assembled TGT probes to four of the coverslips and make sandwiches using the remaining 4 coverslips with the functionalized side facing the probes (eight surfaces require four tubes of hybridized TGT probes). Cover with aluminum foil and incubate for 1 h at RT to allow probe binding to the surface (Figure 2E).
14. After incubation, separate the sandwiches and wash the coverslips with 1x PBS three times. The TGT surfaces are now ready for imaging. Carefully assemble the coverslips into precleaned imaging chambers and add 1x PBS to keep the surfaces hydrated (Figure 2F).
    ​NOTE: Overtightening the chambers will crack the surface. Prevent drying of the surfaces.

3. Cell preparation and staining

1. To investigate the effect of the epidermal growth factor (EGF) stimulation on Cos-7 mechanics, adhesion, and cell spreading, trypsinize Cos-7 cells with 0.05% Trypsin-EDTA for 2 min. Neutralize the trypsin by washing with HBSS and centrifuging at 800 x g for 5 min. Repeat the neutralization step once more.
2. Plate cells at a density of 4 x 10⁴ cells on the assembled TGT surfaces in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 50 ng/mL EGF or DMEM without EGF. Allow the cells to spread for 60 min at 37 °C with 5% CO₂ in a cell culture incubator (Figure 3A).
   NOTE: Cells are incubated in DMEM without serum to avoid stimulation from growth factors. EGF is diluted in 10 mM acetic acid to make a stock of 1 mg/mL. It is used at 50 ng/mL in DMEM for imaging experiments.
3. Following incubation, wash the cells three times with 1x PBS and fix with 2 mL of 4% paraformaldehyde for 12 min at RT (Figure 3B).
   NOTE: All incubation steps are performed on a rotary shaker at ~35 rpm for uniform spreading of the solutions. Protect the TGT surfaces from light by covering them till they are ready for imaging.
4. Aspirate the fixative and wash the coverslips five times with 1x PBS at 5 min intervals at RT. Optionally, incubate the coverslips with 50 mM NH₄Cl in 1x PBS for 30 min at 37 °C to quench paraformaldehyde-associated autofluorescence and wash three times with 1x PBS at 5 min intervals (Figure 3B).
5. Add Buffer A (1x PBS, 5% normal horse serum, 5% normal goat serum, 1% BSA, 0.025% Triton X-100) and incubate for 30 min at 37 °C to block and permeabilize the cells. Wash three times with 1x PBS at 5 min intervals (Figure 3B).
6. Place the imaging chambers with coverslips in a humidity container. Dilute the primary anti-paxillin antibody (focal adhesion marker) at 1:250 in blocking buffer (1x PBS, 5% normal horse serum, 5% normal goat serum, 1% BSA, 0.005% Triton x-100). Incubate with 200 μL of primary antibody solution per coverslip for 2 h at 37 °C (Figure 3B).
   NOTE: Do not let the surfaces dry out.
7. Wash the coverslips five times with 1x PBS at 5 min intervals and return them to the humidity container. Label cells simultaneously with a mixture of dye conjugated goat anti-rabbit secondary antibody at 1:800 dilution and dye conjugated phalloidin (actin) at 1:400 dilution in 200 μL of blocking buffer per coverslip. Incubate at 37 °C for 60 min (Figure 3B).
8. Wash the surfaces five times with 1x PBS at 5 min intervals and store at 4 °C until ready for imaging (Figure 3B).
   NOTE: Image samples within 3 days of surface preparation to avoid signal degradation.

4. Image acquisition

1. Use an oil immersion 60x objective with a high numerical aperture (1.49) on an inverted microscope with 488, 561, and 647 TIRF excitation, RICM excitation, a perfect focus system, and a digital camera.
   1. Add oil to the objective, clean the coverslip bottom of the sample chamber, and place the sample on the stage. Focus on a cell and engage the perfect focus.
2. Put the microscope into the RICM imaging mode with epifluorescence excitation and a GFP filter cube with the emission filter removed. Align the RICM by closing and centering the epi-illumination aperture diaphragm.
3. Put the microscope in TIRF mode with laser excitation and a quad-pass TIRF filter cube. Focus the 488 nm laser to a small spot on the ceiling of the room and increase the angle of incidence until past the critical angle while monitoring fluorescence on the camera in live mode. Observe a sharp reduction in background fluorescence and a single in-focus plane when the critical angle is surpassed.
   NOTE: TIRF excites a thin region (~100 nm) closest to the sample-coverslip interface highlighting open TGT probes and focal adhesions while eliminating out-of-focus fluorescence from within the cell. If TIRF is not available, epi-fluorescence may be used; however, signal-to-noise ratios will be lower.
4. Identify cells for imaging using the "live" mode of the camera using RICM.
5. Acquire the RICM image and TIRF images of actin (640 nm ex), integrin tension (561 nm ex), and paxillin (488 nm ex). Obtain images sequentially using an exposure time of 200 ms.
   NOTE: The exposure time is dependent on many factors, including the objective, laser power, emission filters, and camera sensitivity. The signal should be at least 2x greater than the background. The background is around 1000 AU so the signal should be at least 2000-3000 AU.
6. Repeat 4.4-4.5 for at least 30 cells. Change coverslips, focus, and repeat 4.4-4.5.

5. Data analysis

NOTE: Perform quantitative image analysis using the Fiji software and the analysis using statistics software.

1. Open the image set for one cell.
2. Create a mask of the cell area (RICM mask) by tracing the boundary of the cell in the RICM image using the ImageJ Freehand selection tool. Save the region of interest (ROI) to the ROI manager (Analyze > Tools > ROI manager) (Figure 4A1,2).
3. Pick a representative area outside the cell in the integrin tension image and draw a ROI of at least 200 x 200 pixels. Exclude any other cells or fluorescent debris from the ROI. Measure the background fluorescence in the ROI using the measure tool (Analyze > Measure) (Figure 4A3).
4. Subtract the mean background fluorescence obtained in step 5.2 from the tension image (Process > Math > Subtract) (Figure 4A4).
5. Use the RICM mask established in step 5.2 to define the tension signal within the cell footprint (ROI manager > Select > Apply mask > Edit > Clear outside) (Figure 4A5).
6. Create a threshold mask for the tension image using Huang's method for auto thresholding (Image > Adjust > Threshold) (Figure 4A6). Ensure that the threshold mask best represents the area for the generated integrin tension. As a rule of thumb, set the threshold to 2x the mean background fluorescence.
7. Create a selection of the thresholded tension mask (Edit > Selection > Create) (Figure 4A7).
8. Transfer the selected mask onto the tension image generated in step 5.4 and measure the integrated intensity of open probes (ROI manager > Select (Tension Mask) > Analyze > Measure > RawIntDen) (Figure 4C).
9. Measure the cell morphometric properties area, circularity, and aspect ratio from the RICM mask (ROI manager > Select (RICM mask) > Apply mask > Analyze > Measure) (Figure 4B).
10. Measure the mechanical rupture density, defined as the percent of the cell footprint with ruptured probes by selecting the tension mask image and applying the RICM mask (ROI manager > Select (RICM Mask) > Analyze > Measure > %Area) (Figure 4C).
11. Export the measurements for further analysis and visualization into statistics software.
12. Repeat 5.1-5.11 for every cell.