Quantitative Polymerase Chain Reaction to Enumerate Bacteriophages
Published: June 29, 2023
Abstract
Source: Peng, X., et al., Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (2018)
In this video, we discuss the quantitative polymerase chain reaction, qPCR, to enumerate T7 bacteriophages through DNA quantification. The fluorescent dye in the PCR mixture binds with the newly synthesized DNA strands and emits fluorescence, which is measured.
Protocol
1. Prepare qPCR reactions NOTE: One PCR reaction is for one sample. Each PCR reaction contains 5 µL of qPCR master mix (see materials), 1 µL of 5 µM primer pair mix, 2 µL of H2O, and 2 µL of heat-treated T7 phage sample. For multiple PCR reactions, all the reagents except the phage sample are premixed in one 1.5 mL tube. The volume of each reagent in the premix depends on the number of phage samples for qPCR. Prepare the qPCR pre…
Representative Results
Figure 1: Phage sample treatment, qPCR reaction preparation, and qPCR run. DNase I pretreated T7 phage samples were heated at 100° C for 15 min to release the T7 DNA from intact phage particles (A); the qPCR mixture was prepared as described in the protocol. All the preparations were done on ice (A); qPCR equipment and compatible software (B…
Disclosures
The authors have nothing to disclose.
Materials
| Primers for T7 genomic DNA | IDT | F: CCTCTTGGGAGGAAGAGATTTG R: TACGGGTCTCGTAGGACTTAAT | |
| T7 Select packaging control DNA | EMD Millipore | 69679-1UG | |
| MicroAmp optical 96-well reaction plate | ThermoFisher Scientific | N8010560 | |
| qPCR master mix-Power up SYBR Green master mix | Applied biosystems | Applied biosystems | |
| MicroAmp optical adhesive film kit | ThermoFisher Scientific | ThermoFisher Scientific | |
| UltraPure DNase/RNase-Free Distilled H2O | Invitrogen | 10977015 | |
| ViiA7 Real-Time PCR System with Fast 96-Well Block | ThermoFisher Scientific | 4453535 | |
| QuantStudio Real-time PCR software | ThermoFisher Scientific | v1.2 |
Tags
Cite This Article
Quantitative Polymerase Chain Reaction to Enumerate Bacteriophages. J. Vis. Exp. (Pending Publication), e21357, doi: (2023).