All experiments were completed in accordance and compliance with all relevant regulatory and institutional guidelines, including the Institutional Animal Care and Use Committee at the Johns Hopkins School of Medicine.

1. Animals

1. Obtain male adolescent Sprague-Dawley rats at 4 weeks of age. House the animals in polycarbonate rat cages in a temperature-and humidity-controlled room on a 12 h light, 12 h dark cycle with light onset at 0600 h. Provide the animals with ad libitum access to water.
2. Allow rats to acclimate for 1 week to reduce stress associated with transportation. Pair-house the animals (N=16) to preclude isolation stress, and at 5 weeks of age, begin the chronic variable stress (CVS) regimen for 3 weeks.

2. Chronic Variable Stress

1. Administer the CVS regimen once in the morning (9-11 AM) and once in the afternoon (1–3 PM) at irregular times to keep the routine unpredictable. Incorporate overnight mild stressors. The CVS regimen includes: 1) 3 h in a restraint cylinder; 2) 10 min swim; 3) 3 h cage tilt 4) 1 h slow shaking platform; and 5) 1 h in the 4 °C cold room.
   Note: Overnight stressors include social crowding (5 per cage), social isolation, wet bedding, food restriction, and lights-on. A typical weekly schedule of the stress regimen is provided in Table 1.

3. Endocrine Assays

1. Determine levels of corticosterone (CORT) using tail blood (~50 μL) samplings collected at the same time (9 AM) twice per week throughout the experiment, prior to CVS regimen to establish baseline hormone levels (Day 0), once during the middle of the weekly CVS (Days 4,11, and 18), after every 7 days of CVS (Days 7 and 14), and at the conclusion of CVS (Day 21). Collect blood samples prior to the daily stress regimen.
   1. Collect one final trunk blood sample during euthanasia (Day 25) for RIA and genomic DNA extraction.
2. Centrifuge all blood samples (600 x g, 4 °C, 10 min) to separate the plasma from the blood cells. Pipet out the plasma (supernatant) and store the samples at -80 °C.
3. Thaw and use the plasma to determine CORT levels by radioimmunoassay (RIA). Ensure that the 3 week plasma CORT levels are elevated in the stressed animals to verify the robustness of the stress regimen.

4. Behavior

1. After the CVS regimen (Days 23–24), assess each animal for anxiety-like behavior on the elevated plus maze (EPM)¹⁴.
2. Using a video camera, record the animals on the EPM apparatus for 300 s and score the time spent in the center, closed arms, and open arms.

5. Design of the Rat Methyl-Seq

1. Using the UCSC Genome Browser, obtain non-redundant genomic coordinates (rat Nov 2004 rn4 assembly) for CpG islands and island shores (± 1 kb flanking CpG islands), promoters (± 1 kb of each TSS) of each RefSeq gene, and other sequences that may be available from relevant literature.
   Note: For the rat Methyl-Seq, ­­additional GC-rich sequences from a previous array-based methylation platform was added¹². For regions greater than 5 kbps, alternating regions of 500 bps were sampled followed by 1 kbps that were skipped. The final rat Methyl-Seq design consists of 111 Mbps, 2.3 million CpGs; and an average region size of 594 bps. It targets 228,800 unique loci.
2. Enter a compiled list of genomic coordinates into a commercially-available target capture design software for appropriate probe design.

6. Construction of the Rat Methyl-Seq Library from Genomic DNA

NOTE: To eliminate batch effects, process multiple samples at the same time, and scale up the master mixes accordingly. Extract DNA using a commercially available DNA extraction kit. Column- or precipitation-based methods both yield high-quality genomic DNA (260/280 ratio ~1.8). Use of phenol-based methods are not recommended. Elute or resuspend DNA in Low TE buffer (10 mM TE, 0.1 mM EDTA, pH 8.0).

1. Sample Preparation
   NOTE: For every step using DNA-binding magnetic beads, make sure the beads are acclimated to room temperature for at least 30 min and well mixed before use.
   1. Shear DNA
      1. Use a fluorometer to determine initial double-stranded DNA concentration of each sample. Dilute >1 µg of gDNA to 50 µL with Low TE buffer (10 mM TE, 0.1 mM EDTA, pH 8.0) in low DNA-binding microcentrifuge tubes.
      2. Shear samples using an isothermal sonicator (10% Duty Cycle, 5 Intensity, 200 Cycles per Burst, 6 cycles of 60 s, Frequency sweeping, 4 °C).
      3. Assess quality of DNA using an electrophoresis-based system that measures DNA size and quantity.
         NOTE: The DNA amount recommended is 1 µg, or 3 µg. If there is limited starting material, the lowest input amount should be >500 ng, as lower amounts will adversely affect the quantity and quality of the libraries generated.
   2. Repair DNA ends.
      1. Use the rat Methyl-Seq kit to prepare the End-repair Master Mix on ice. Add 52 µL of mix to each sample and incubate in a thermal cycler without a heated lid (20 °C for 30 min, 4 °C hold).
         End-repair Master Mix (per sample):
         35.2 µL of Water
         10 µL of End Repair Buffer (10x)
         1.6 µL of dNTP Mix
         1 µL of T4 DNA Polymerase
         2 µL of Klenow DNA Polymerase
         2.2 µL of T4 Polynucleotide Kinase
      2. Purify samples using 180 µL of DNA-binding magnetic beads and 400 µL of freshly prepared 70% ethanol per sample. Add 180 µL of beads to each sample and incubate for 5 min at room temperature. Pellet beads, remove supernatant and resuspend pellet in 200 µL of 70% ethanol. Remove ethanol and repeat wash once.
      3. Use a magnetic plate to pellet beads and remove as much ethanol as possible. Dry in a 37 °C heatblock for 3–5 min until the bead pellet is completely dry. Resuspend in 44 µL of nuclease-free water and collect approximately 42 µL of supernatant.
         Stopping Point: After repairing DNA ends, samples may be sealed and stored at -20 °C.
   3. Adenylate the 3’ ends.
      1. Prepare Adenylation Master Mix on ice. Add 9 µL mix to each sample and incubate in a thermal cycler without a heated lid (37 °C for 30 min, 4 °C hold).
         Adenylation Master Mix (per sample):
         5 µL of Klenow buffer
         1 µL of dATP
         3 µL of Klenow DNA Polymerase
      2. Purify samples using 90 µL of DNA-binding magnetic beads and 400 µL of freshly prepared 70% ethanol per sample. Add 90 µL of beads to each sample and incubate for 5 min at room temperature. Pellet beads, remove supernatant and resuspend pellet in 200 µL of 70% ethanol. Remove ethanol and repeat wash once.
      3. Use a magnetic plate to pellet beads and remove as much ethanol as possible. Dry in a 37 °C heatblock for 3–5 min until the bead pellet is completely dry. Resuspend in 35 µL of nuclease-free water and collect approximately 33.5 µL of supernatant.
   4. Ligate the methylated adapter.
      1. Prepare Ligation Master Mix on ice and add 16.5 µL of mix to each sample. Incubate in a thermal cycler without a heated lid (20 °C for 15 min, 4 °C hold).
         Ligation Master Mix (per sample):
         2.5 µL of Water
         2.5 µL of Methyl-Seq Methylated Adapter
         10 µL of T4 DNA Ligase Buffer (5x)
         1.5 µL of T4 DNA Ligase
      2. Purify samples using 90 µL of DNA-binding magnetic beads and 400 µL of freshly prepared 70% ethanol per sample. Add 90 µL of beads to each sample and incubate for 5 min at room temperature. Pellet beads, remove supernatant, and resuspend pellet in 200 µL of 70% ethanol. Remove ethanol and repeat wash once.
      3. Use a magnetic plate to pellet beads and remove as much ethanol as possible. Dry in a 37 °C heatblock for 3–5 min until the bead pellet is completely dry. Resuspend in 22 µL of nuclease-free water and collect approximately 22 µL of supernatant. Assess quality using a bioanalyzer.
         Note: If the total amount of DNA is less than 500 ng, shear and process additional DNA prior to proceeding with the subsequent steps. If the average DNA size does not increase by more than 30 bps, check to ensure that the reagents are new, as T4 DNA polymerase, Klenow, and/or T4 ligase may be old.
         Stopping Point: After ligating methylated adapter, samples may be sealed and stored at -20 °C.
2. Hybridization
   1. Transfer samples to low DNA-binding microcentrifuge tubes and use a heated vacuum concentrator to reduce sample volume to less than 3.4 µL. Reconstitute samples to 3.4 µL.
      NOTE: Concentrate the samples to approximately ~3 µL to ensure samples are removed from vacuum concentrator before all liquid evaporates.
   2. Prepare hybridization buffer at room temperature and Methyl-Seq Block Mix on ice. Add 5.6 µL of Methyl-Seq Block Mix to each sample and incubate in thermal cycler (95 °C for 5 min, 65 °C for 2 min, 65 °C hold).
      Hybridization Buffer (per sample):
      6.63 µL of Methyl-Seq Hyb 1
      0.27 µL of Methyl-Seq Hyb 2
      2.65 µL of Methyl-Seq Hyb 3
      3.45 µL of Methyl-Seq Hyb 4
      Methyl-Seq Block Mix (per sample):
      2.5 µL of Methyl-Seq Indexing Block 1
      2.5 µL of Methyl-Seq Block 2
      0.6 µL of Methyl-Seq Block 3
   3. Prepare RNase Block Mix and the Capture Library hybridization mix. Add 20 µL of Capture Library Hybridization Mix to each sample and incubate at 65 °C for at least 16 h.
      RNase Block Mix (per sample):
      0.5 µL of RNase Block
      1.5 µL of Water
      Capture Library Hybridization Mix (per sample):
      13 µL of Hybridization Buffer
      2 µL of RNase Block Mix
      5 µL of Rat Methyl-Seq Capture Library
      NOTE: Keep reactions at 65 °C when adding Hybridization Mix to prevent non-specific binding.
   4. Aliquot 50 µL of streptavidin magnetic beads per sample into a new 8-well strip tube. Wash beads with 200 µL of Methyl-Seq Binding Buffer. Use magnetic plate to pellet beads and remove supernatant between each wash for a total of 3 washes. After the final wash, resuspend streptavidin beads in 200 µL of Methyl-Seq Binding Buffer.
   5. Add samples to 200 µL of washed streptavidin magnetic beads and incubate at room temperature for 30 min using a rotating mixer. While mixing, aliquot 200 µL of Methyl-Seq Wash Buffer 2 into triplicate wells of a 96-well plate per sample and place in a thermal cycler to pre-warm to 65 °C.
   6. After incubation, pellet streptavidin magnetic beads using magnetic plate and resuspend the beads in 200 µL Methyl-Seq Wash Buffer 1. Incubate for 15 min at room temperature. Use a magnetic plate to pellet and discard supernatant.
   7. Wash beads 3 times with Methyl-Seq Wash Buffer 2: resuspend bead pellet in 200 µL of Wash Buffer 2 (pre-warmed in step 6.2.5.), incubate beads in thermal cycler (65 °C, 10 min), and pellet beads. Discard supernatant after each wash using a magnetic plate.
      NOTE: Maintain hybridization reactions at 65 °C when adding Wash Buffer 2 to prevent non-specific binding.
   8. Add 20 µL of Methyl-Seq Elution Buffer to the washed beads and incubate at room temperature for 20 min. Use a magnetic plate to pellet beads and transfer supernatant to a new strip tube. Discard the beads.
      Note: While incubating, prepare bisulfite conversion reagent.
3. Bisulfite Conversion
   NOTE: Perform bisulfite conversion of the eluted ssDNA using appropriate reagents and instructions from a commercially-available bisulfite conversion kit.
   1. Add 130 µL prepared bisulfite conversion reagent to supernatant from previous step. Divide each of the 150 µL reactions equally into two wells. Incubate in a thermal cycler (64 °C for 2.5 h, 4 °C hold).
      NOTE: The 150 µL reaction is divided equally into two separate wells to ensure homogenous temperature. After incubating for 2.5 h, immediately proceed to the next step.
   2. Bind samples to spin columns by adding 600 µL of Binding Buffer and wash once with 100 µL of Wash Buffer. Centrifuge columns (15,000 x g, 1 min) between all bisulfite conversion steps and discard flow through.
   3. Desulphonate samples by adding 200 µL of Desulphonation Buffer to columns. Incubate at room temperature for 15 – 20 min. Repeat centrifugation and discard flow through.
   4. Wash columns twice with 200 µL of Wash Buffer. Elute each sample by adding 10 µL of Elution Buffer to the column, incubating for 3 min at room temperature, and centrifuging (15,000 x g, 1 min). Repeat elution step for a total of 20 µL.
   5. Prepare PCR reaction Master Mix 1 on ice. Add 82 µL of mix to each sample. Incubate in a thermal cycler with the following program.
      PCR Reaction Master Mix 1 (per sample):
      30 µL of Water
      50 µL of Methyl-Seq PCR Master Mix
      1 µL of Methyl-Seq PCR1 Primer F
      1 µL of Methyl-Seq PCR1 Primer R
      Thermal Cycler Program:
      Stage 1, 1 cycle: 95 °C 2 min
      Stage 2, 8 cycles: 95 °C 30 s, 60 °C 30 s, 72 °C 30 s
      Stage 3, 1 cycle: 72 °C 7 min
      Stage 4, 1 cycle: 4 °C Hold
   6. Purify samples using 180 µL of DNA-binding magnetic beads and 400 µL of freshly prepared 70% ethanol per sample. Add 180 µL of beads to each sample and incubate for 5 min at room temperature. Pellet beads, remove supernatant and resuspend pellet in 200 µL of 70% ethanol. Remove ethanol and repeat wash once.
   7. Use a magnetic plate to pellet beads and remove as much ethanol as possible. Dry in a 37 °C heatblock for 3–5 min until the bead pellet is completely dry. Resuspend in 21 µL of nuclease-free water and collect approximately 19.5 µL of supernatant.
4. Indexing
   1. Prepare PCR reaction Master Mix 2 on ice. Add 25.5 µL Master Mix 2 to each sample. Add 5 µL commercial indexing primers to individual samples and incubate in a thermal cycler.
      PCR Reaction Master Mix 2 (per sample):
      25 µL Methyl-Seq PCR Master Mix
      0.5 µL Methyl-Seq Common Indexing Primer
      Thermal Cycler Program:
      Stage 1, 1 cycle: 95 °C 2 min
      Stage 2, 6 cycles: 95 °C 30 s, 60 °C 30 s, 72 °C 30 s
      Stage 3, 1 cycle: 72 °C 7 min
      Stage 4, 1 cycle: 4 °C Hold
      NOTE: Additional cycles (2 – 3) may be necessary if the starting DNA concentration is below recommended values.
   2. Purify samples using 90 µL of DNA-binding magnetic beads and 400 µL of freshly prepared 70% ethanol per sample. Add 90 µL of beads to each sample and incubate for 5 min at room temperature. Pellet beads, remove supernatant and resuspend pellet in 200 µL of 70% ethanol. Remove ethanol and repeat wash once.
   3. Use a magnetic plate to pellet beads and remove as much ethanol as possible. Dry in a 37 °C heatblock for 3–5 min until the bead pellet is completely dry. Resuspend in 24 µL of nuclease-free water and collect approximately 24 µL of supernatant.
   4. Assess concentration and bp size using the high-sensitivity DNA detection reagents on a bioanalyzer.
      Note: If the bioanalyzer fails to detect the presence of the library DNA, repeat the preparation steps with additional DNA.
      Stopping point: After purification, indexed samples may be sealed and stored at -20 °C.
   5. Pooling Samples for the appropriate next-generation sequencing platform used.
      1. Using the concentration data from the bioanalyzer, which determines DNA molarity based on library size and quantity in a given volume, dilute with Low TE buffer (6.1.1.1) and combine all samples to a final concentration of 15 pM.
         NOTE: A more sensitive method of quantifying the library is by quantitative real-time PCR using primers that target the ligated adapters.
      2. Run pooled samples on the number of lanes that are sufficient for 4 samples per lane on a next-generation sequencer.
         NOTE: For instance, if 16 library samples have been uniquely indexed and combined, run the libraries over 4 lanes, equivalent to 4 samples per lane.

7. Sequencing on a Next-generation Sequencer

1. Send the samples to the institutional sequencing core for clustering of the Methyl-Seq library, followed by sequencing on a next-generation sequencing machine.

8. Analysis to Identify DMRs

1. Implement Bismark¹⁵, which invokes Bowtie 2.0 as an internal sequence aligner^16,17, to align raw input reads to bisulfite-converted, plus-strand genome. Following alignment, use the Bismark_methylation_extractor to perform quality control and assign an estimated methylation value to each CpG.
2. Generate a list of DMRs with the BS-Seq package¹⁸ in Bioconductor. Filter the DMRs based on having greater than 3 consecutive CpGs and P-value <0.05.
   NOTE: Generate a DMR list that includes genomic coordinates, distance to the nearest RefSeq gene, number of CpGs within each DMR, average% CpG methylation value across the DMR for the two comparison groups (e.g., stressed vs. unstressed), the P-value, and the FDR (false discovery rate) value. Use the DMR list, i.e., genomic coordinates, to design pyrosequencing primers for validation.

9. Validation by Bisulfite Pyrosequencing

1. Primer Design
   1. Design primers for bisulfite PCR and pyrosequencing. Design two sets of PCR primers (outside and nested) so that the nested PCR will amplify 150–400 bps of a DMR.
      NOTE: In general, designed primers are at least 24 bases long with at least 4–5 non-consecutive G’s (C’s for the reverse primer) to account for reduced annealing temperature from loss of sequence complexity. One of the nested primers will be biotin-labeled and HPLC-purified. However, standard primers should be ordered first to optimize the PCR step by resolving the reactions on an agarose gel.
      1. Design the pyrosequencing assay primer so that it targets the complementary biotinylated strand just 1–2 bases upstream of the CpGs to be assayed. Design multiple pyrosequencing primers as necessary, as each pyrosequencing primer can reliably assay 30 bps downstream.
   2. For the Rt1-m4, use the following:
      rRT1M4 Outside – F TGTAYGATTTTGGTTATYGTAAAT
      rRT1M4 Outside – R AACTTACAAATTTCACCAACTCA
      rRT1M4 Nested – F GTGGGTTAYGTGGATAATATATAG
      rRT1M4 Nested – R AATCACTTACCATTCTCTCTCTAACTA
      rRT1M4 Pyro1 TAYGTGGATAATATATAGAT
      rRT1M4 Pyro2 GATAGTTATTTGGYGAGTTAG
      rRT1M4 Pyro3 GAGTATTTGGAGGAGTTGAT
      rRT1M4 Pyro4 GGATTTTAATATTTGGT
2. Use a commercially-available kit for bisulfite conversion of rat blood gDNA.
   NOTE: The bisulfite conversion steps have been adapted from the commercially-available kit with the following modifications: In step 1, add 50–100 ng of blood gDNA and dilute with water to 20 µL. In step 9, elute 20 µL per sample.
   1. Prepare bisulfite conversion reagent according to the manufacturer’s protocol and combine with diluted gDNA. Incubate in thermal cycler (64 °C for 2.5 h, 4 °C hold).
   2. Add Binding Buffer to converted gDNA in spin columns and centrifuge (15,000 x g, 1 min). Wash columns once then add Desulphonation Buffer to the columns and incubate for 15 min at room temperature. Centrifuge (15,000 x g, 1 min).
   3. Wash column with Wash Buffer and centrifuge (15,000 x g, 1 min). Repeat wash step with centrifugation (15,000 x g, 2 min). Add 20 µL Elution Buffer and centrifuge (15,000 x g, 1 min) to elute.
3. PCR amplification
   1. Prepare Outside PCR Master Mix. Add 21.5 µL of Master Mix to 3.5 µL bisulfite-converted gDNA and run thermal cycler program.
      Outside PCR Master Mix:
      16.25 µL of Water
      2.5 µL of Polymerase Buffer [10x]
      0.5 µL of dNTP [10 mM]
      1 µL of Forward Primer [0.1 µM]
      1 µL of Reverse Primer [0.1 µM]
      0.25 µL of Taq DNA Polymerase [5000 U/mL].
      Thermal cycler program:
      Stage 1, 1 cycle: 94 °C 4 min
      Stage 2, 47 cycles: 94 °C 1 min, 53 °C 30 s, 72 °C 1 min
      Stage 3, 1 cycle: 72 °C 8 min, 4 °C Hold
   2. Prepare Nested PCR Master Mix. Add 23 µL of Master Mix to 2 µL of sample from outside PCR and repeat the outside PCR thermal cycler program. Assess PCR product quality through gel electrophoresis (1x TAE buffer, 1% agarose gel).
      Nested PCR Master Mix:
      17.75 µL of Water
      2.5 µL of Polymerase Buffer [10x]
      0.5 µL of dNTP [10 mM]
      1 µL of Forward Primer [0.1 µM]
      1 µL of Reverse Primer [0.1 µM]
      0.25 µL of Taq DNA Polymerase [5000 U/mL]
      Note: For nested PCR, either the forward or the reverse primer must be biotinylated.
4. Pyrosequencing
   1. Make a master mix containing 38 µL of Binding Buffer, 35 µL of water, and 2 µL of streptavidin-coated sepharose beads per sample. In a 96-well plate, add 75 µL of master mix and 5 µL of nested PCR product. Shake on a plate shaker for 15 – 60 min.
   2. While shaking, add 12 µL of primer (0.5 µM, diluted in annealing buffer) into the wells of a pyrosequencing assay plate.
   3. After shaking, perform wash steps using binding reaction wash buffers. Place vacuum tool in trough filled with water then collect samples from plate. Submerge vacuum tool in half-filled troughs containing 70% ethanol, NaOH (0.2 M), and Tris acetate buffer (10 mM, pH 7.4). Disconnect from vacuum and place vacuum tool in HS assay plate to transfer beads.
   4. Place plate on heat block and incubate at 80 °C for 2 min. Allow plate to cool for 5 min then begin pyro program.