Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba – The University of Arizona
Demonstrating Author: Bradley Schmitz
Quantitative polymerase chain reaction (qPCR), also known as real-time PCR, is a widely-used molecular technique for enumerating microorganisms in the environment. Prior to this approach, quantifying microorganisms was limited largely to classical culture-based techniques. However, the culturing of microbes from environmental samples can be particularly challenging, and it is generally held that as few as 1 to 10% of the microorganisms present within environmental samples are detectable using these techniques. The advent of qPCR in environmental microbiology research has therefore advanced the field greatly by allowing for more accurate determination of concentrations of microorganisms such as disease-causing pathogens in environmental samples. However, an important limitation of qPCR as an applied microbiological technique is that living, viable populations cannot be differentiated from inactive or non-living populations.
This video demonstrates the use of qPCR to detect pepper mild mottle virus from an environmental water sample.
The basic principles behind qPCR is the same as regular PCR – repeated cycles of primer annealing to template, elongation of PCR product, and denaturation of product from template, leading to the exponential amplification of a target sequence of interest, known as the “amplicon”, from a pool of starting material. The innovation of qPCR is in the addition of fluorescent chemicals into the reaction, which allows the synthesis of PCR product at each cycle to be directly visualized in “real time” by specialized thermocyclers, making it possible to quantify the amount of template sequence in the original sample. The quantity is usually measured in terms of the threshold cycle (Ct, also known as quantification cycle or Cq), which is the PCR cycle at which the amount of fluorescent products exceeds the background level.
Quantification can be relative, where the Ct value of one sequence is compared to that of another standard or control sequence. Alternatively, if a series of DNA of known quantity is run alongside the samples in the reaction, a “standard curve” comparing fluorescence value to DNA amount can be produced, and allows the sample DNA to be quantitated absolutely.
In one qPCR method, a short stretch of DNA, known as a probe, is designed against a specific target sequence of interest. The probe is chemically attached to a fluorescent dye as well as a “quencher” molecule that suppresses the fluorescence signal from the dye when in close proximity. The polymerase enzyme, which synthesizes the DNA product, has a DNA-degrading activity that would cause the fluorescent molecule to be released from the probe, thus separating the dye from the quencher and allowing the fluorescence signal to be detected. Fluorophore levels are quantitatively measured after each PCR cycle, with increasing signal strength correlating to higher levels of amplified target sequences (termed “amplicons”) present within the environmental sample.
1. Sample Collection
2. Nucleic Acids Extraction
3. Reverse Transcription
4. Setting up qPCR
5. qPCR Operation
| Reagent | Sequence (5’ → 3’) | Volume (μL / well) | Final Conc. |
| Forward Primer | GAGTGGTTTGACCTTAACGTTTGA | 2.25 | 900 nM |
| Reverse Primer | TTGTCGGTTGCAATGCAAGT | 2.25 | 900 nM |
| Probe | FAM-CCTACCGAAGCAAATG-BHQ1 | 1.0 | 200 nM |
Table 1. Sample primer and probe sequences for detecting pepper mild mottle virus.
| Reagent | Volume (μL / well) | Number of Wells | Master Mix Volume (μL) |
| LC 480 Mix | 12.5 | 26 | 325 |
| Molecular H2O | 4.5 | 117 | |
| Forward Primer | 2.25 | 58.5 | |
| Reverse Primer | 2.25 | 58.5 | |
| Probe | 1.0 | 26 | |
| Total | 22.5 | 585 |
Table 2. Reagent volumes for individual reaction and master mix.
The advent of quantitative polymerase chain reaction, or qPCR, has made it possible to quantitatively determine the amount of any microorganism in an environmental sample.
Like standard PCR, qPCR identifies microorganisms by detecting for the presence or absence of DNA sequences specific to the organisms of interest. This allows for the detection of microbes that cannot be cultured in lab, making it possible to assay a much wider range of environmental organisms. In addition, qPCR allows the amount of DNA to be quantitatively assessed. But at the same time, PCR methodologies detect DNA from all organisms dead or alive, limiting the ability to only look for actively growing microbes in the sample.
This video will review the chemical innovations that distinguish qPCR from regular PCR, explain how qPCR can be used to quantitatively measure DNA, demonstrate a protocol for using qPCR to detect an RNA virus from soil samples, and finally, show how qPCR is being applied to environmental microbiology today.
The basic principles behind qPCR are the same as regular PCR – repeated cycles of primer annealing to template, elongation of PCR product, and denaturation of product from template, leading to the exponential amplification of a target sequence of interest, known as the amplicon, from a pool of starting material.
The innovation of qPCR is in the addition of fluorescent chemicals into the reaction, which allows the synthesis of PCR product at each cycle to be directly visualized in "real time" by specialized thermocyclers, making it possible to quantify the amount of template sequence in the original sample. The quantity is usually measured in terms of the threshold cycle, abbreviated Ct, also known as the quantification cycle or Cq, which is the PCR cycle at which the amount of fluorescent products exceeds the background level.
Quantification can be relative, where the Ct value of one sequence is compared to that of another standard or control sequence; the relative quantity is equal to two raised to the power of the difference in Ct. Alternatively, if a series of DNA of known quantity is run alongside the samples in the reaction, a standard curve comparing fluorescence value to DNA amount can be produced, and allows the sample DNA to be quantitated absolutely.
There are two broad types of fluorescent molecules used in qPCR. In one case, fluorescent dyes that bind specifically to double-stranded DNA is included in the reaction. The dye only fluoresces when bound to DNA, thus allowing the amount of double-stranded DNA product to be quantitated.
In the other method, a short stretch of DNA, known as a probe, is designed against a specific target sequence of interest. The probe is chemically attached to a fluorescent dye as well as a "quencher" molecule that suppresses the fluorescence signal from the dye when in close proximity. The polymerase enzyme, which synthesizes the DNA product, has a DNA-degrading activity that would cause the fluorescent molecule to be "released" from the probe, thus separating the dye from the quencher and allowing the fluorescence signal to be detected.
Now that you understand the principles behind qPCR, let's look at a protocol for using this technique to identifying an RNA virus that infects plants, the pepper mild mottle virus, from soil samples.
In this demonstration, sample will be collected from the rhizosphere, the zone of soil approximately 7 mm around plant roots that is influenced by the roots and their symbiotic microorganisms.
To collect rhizosphere soil, first carefully extract the plant of interest from the ground, and hit it to remove as much excess bulk soil as possible. Package the plant for further processing in the lab.
After bringing the samples back to the lab, use a sterile spatula to scrap the desired soil into a collection vessel. Then, collect the virus from the soil and extract the RNA.
Once RNA is collected from the sample, convert it into complementary or cDNA via reverse transcription. Please refer to the JoVE SciEd video on reverse transcription-PCR for details of this procedure.
When ready to perform the qPCR, thaw frozen reagents at room temperature inside a dedicated laminar flow hood, and place on ice once thawed. Reagent components containing the DNA polymerase enzyme should always be kept on ice.
Thaw the sample cDNA and a positive control DNA, such as a circular piece of DNA known as a plasmid that has the amplicon of interest cloned into it.
Before assembling the reactions in a 96-well qPCR plate, prepare a 96-cell table template on paper, and label each cell with the reaction that will be loaded into the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.
Calculate the reagent volumes needed for a reaction "master mix", which includes all of the reagents that are constant among the reactions. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error.
Once the reagents are thawed, assemble the master mix in a 1.5-mL low-adsorption microfuge tube. To do this, briefly vortex each reagent to mix thoroughly, collect any liquid on the side of the tubes using a mini-centrifuge, and pipette the reagent into the microfuge tube. Be sure to use new pipette tips for each reaction component. After all reagents have been added, vortex to mix and centrifuge. Then, aliquot the appropriate amount of master mix into the designated wells on the PCR plate.
Next, vortex and centrifuge each tube with sample and control DNA, and pipette the appropriate amount into the respective wells on the PCR plate. Once samples have been added, seal the plate with a sealing foil, and use the sealing tool to fully flatten the seal and push out any air bubbles. Carefully tear off the non-adhesive tabs from the ends of the seal.
To fully collect the reaction mixture into the bottom of the wells, place the reaction plate into a centrifuge with a plate-holder and properly balance the rotor with a counterweight plate. Pulse-centrifuge the plate up to 1,000 rpm, then let the centrifuge slowly come to a stop without brakes.
Place the reaction plate into the qPCR machine. Set the PCR program according to the manufacturer's specification, setting the melting temperature according to the primer pair being used. Set the reaction program to run.
Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated.
Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction.
With the results from the qPCR, the volume transferred into the wells, the extraction from soil, and the factor from the reverse transcription, the number of viruses in the initial soil sample can be calculated.
Now that you know how qPCR is performed, let's look at how it can be used to analyze different environmental samples.
qPCR can be used to quantify the amount of viruses recovered from many different types of samples. In this application, two different kinds of adenoviruses were concentrated from water samples by a number of different methods. DNA was then extracted from the viruses and subjected to qPCR, to evaluate the relative efficiency of the concentration methods.
Another application for qPCR-based microbial enumeration is to quantify bacterial content in food and agricultural samples – in this example, fecal and litter samples from chicken farms. Rather than targeting individual species, the scientists performed qPCR using primers against a highly conserved gene found in all bacteria and quantified the total bacterial community found in the samples.
Finally, as mentioned earlier, one disadvantage of traditional qPCR methodology is that live and dead microbes cannot be distinguished. However, by adding a chemical known as propidium monoazide, or PMA, which can only enter dead cells where it binds to DNA to inhibit subsequent enzymatic reactions such as PCR, researchers here were able to distinguish between live and dead cultures of E. coli O157:H7, a common pathogenic strain found in contaminated food and water.
You've just watched JoVE's introduction to quantifying environmental microorganisms and viruses using qPCR. You should now understand how qPCR works, how to use qPCR to measure the amount of a microbe in an environmental sample, and some applications of this technique. Thanks for watching!
The ability to quantify targeted genomic segment copies using the qPCR technique is of importance in a number of scientific fields. Example applications include:
(1) Enumerating pathogens in water, soil, food, surfaces, etc.
Real-time PCR is utilized to enumerate pathogens in various environments. During outbreaks, water and soil samples can be analyzed for the pathogen of interest to find the source causing spread. The source can then be further analyzed to enumerate the concentration of the pathogen and determine the amount of contamination. For example, during an outbreak of norovirus on a cruise ship that has caused severe gastroenteritis, vomiting, and diarrhea to among passengers, water and food samples may be subjected to real-time PCR to identify the source of the virus, e.g., water that was not properly treated and contained high fecal contamination.
(2) Measuring the reduction of pathogenic microbes by wastewater treatment
Raw sewage water contains an abundance of disease-causing microorganisms and therefore must be treated in order to protect public health. Water samples can be collected at different points along a wastewater treatment train, and analyzed using qPCR to determine the reduction in levels of pathogenic microorganisms including viruses. The calculated reductions then provide valuable information as to the effectiveness of wastewater treatment processes and potential water reuse applications.
(3) Measuring functional gene markers in the environment
Microbial communities are subject to changes in membership and fluctuations in activity due to environmental pressures. These shifts can be monitored via analysis of functional genes that might be activated by particular environmental stressors. Real-time PCR can be used to quantify the expression of these genes in samples to monitor changes in microbial community activity. For example, qPCR allows microbial ecologists to quantify the expression of genes activated for biodegradation pathways in the presence of man-made contaminants present in soils.
The advent of quantitative polymerase chain reaction, or qPCR, has made it possible to quantitatively determine the amount of any microorganism in an environmental sample.
Like standard PCR, qPCR identifies microorganisms by detecting for the presence or absence of DNA sequences specific to the organisms of interest. This allows for the detection of microbes that cannot be cultured in lab, making it possible to assay a much wider range of environmental organisms. In addition, qPCR allows the amount of DNA to be quantitatively assessed. But at the same time, PCR methodologies detect DNA from all organisms dead or alive, limiting the ability to only look for actively growing microbes in the sample.
This video will review the chemical innovations that distinguish qPCR from regular PCR, explain how qPCR can be used to quantitatively measure DNA, demonstrate a protocol for using qPCR to detect an RNA virus from soil samples, and finally, show how qPCR is being applied to environmental microbiology today.
The basic principles behind qPCR are the same as regular PCR – repeated cycles of primer annealing to template, elongation of PCR product, and denaturation of product from template, leading to the exponential amplification of a target sequence of interest, known as the amplicon, from a pool of starting material.
The innovation of qPCR is in the addition of fluorescent chemicals into the reaction, which allows the synthesis of PCR product at each cycle to be directly visualized in “real time” by specialized thermocyclers, making it possible to quantify the amount of template sequence in the original sample. The quantity is usually measured in terms of the threshold cycle, abbreviated Ct, also known as the quantification cycle or Cq, which is the PCR cycle at which the amount of fluorescent products exceeds the background level.
Quantification can be relative, where the Ct value of one sequence is compared to that of another standard or control sequence; the relative quantity is equal to two raised to the power of the difference in Ct. Alternatively, if a series of DNA of known quantity is run alongside the samples in the reaction, a standard curve comparing fluorescence value to DNA amount can be produced, and allows the sample DNA to be quantitated absolutely.
There are two broad types of fluorescent molecules used in qPCR. In one case, fluorescent dyes that bind specifically to double-stranded DNA is included in the reaction. The dye only fluoresces when bound to DNA, thus allowing the amount of double-stranded DNA product to be quantitated.
In the other method, a short stretch of DNA, known as a probe, is designed against a specific target sequence of interest. The probe is chemically attached to a fluorescent dye as well as a “quencher” molecule that suppresses the fluorescence signal from the dye when in close proximity. The polymerase enzyme, which synthesizes the DNA product, has a DNA-degrading activity that would cause the fluorescent molecule to be “released” from the probe, thus separating the dye from the quencher and allowing the fluorescence signal to be detected.
Now that you understand the principles behind qPCR, let’s look at a protocol for using this technique to identifying an RNA virus that infects plants, the pepper mild mottle virus, from soil samples.
In this demonstration, sample will be collected from the rhizosphere, the zone of soil approximately 7 mm around plant roots that is influenced by the roots and their symbiotic microorganisms.
To collect rhizosphere soil, first carefully extract the plant of interest from the ground, and hit it to remove as much excess bulk soil as possible. Package the plant for further processing in the lab.
After bringing the samples back to the lab, use a sterile spatula to scrap the desired soil into a collection vessel. Then, collect the virus from the soil and extract the RNA.
Once RNA is collected from the sample, convert it into complementary or cDNA via reverse transcription. Please refer to the JoVE SciEd video on reverse transcription-PCR for details of this procedure.
When ready to perform the qPCR, thaw frozen reagents at room temperature inside a dedicated laminar flow hood, and place on ice once thawed. Reagent components containing the DNA polymerase enzyme should always be kept on ice.
Thaw the sample cDNA and a positive control DNA, such as a circular piece of DNA known as a plasmid that has the amplicon of interest cloned into it.
Before assembling the reactions in a 96-well qPCR plate, prepare a 96-cell table template on paper, and label each cell with the reaction that will be loaded into the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.
Calculate the reagent volumes needed for a reaction “master mix”, which includes all of the reagents that are constant among the reactions. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error.
Once the reagents are thawed, assemble the master mix in a 1.5-mL low-adsorption microfuge tube. To do this, briefly vortex each reagent to mix thoroughly, collect any liquid on the side of the tubes using a mini-centrifuge, and pipette the reagent into the microfuge tube. Be sure to use new pipette tips for each reaction component. After all reagents have been added, vortex to mix and centrifuge. Then, aliquot the appropriate amount of master mix into the designated wells on the PCR plate.
Next, vortex and centrifuge each tube with sample and control DNA, and pipette the appropriate amount into the respective wells on the PCR plate. Once samples have been added, seal the plate with a sealing foil, and use the sealing tool to fully flatten the seal and push out any air bubbles. Carefully tear off the non-adhesive tabs from the ends of the seal.
To fully collect the reaction mixture into the bottom of the wells, place the reaction plate into a centrifuge with a plate-holder and properly balance the rotor with a counterweight plate. Pulse-centrifuge the plate up to 1,000 rpm, then let the centrifuge slowly come to a stop without brakes.
Place the reaction plate into the qPCR machine. Set the PCR program according to the manufacturer’s specification, setting the melting temperature according to the primer pair being used. Set the reaction program to run.
Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated.
Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction.
With the results from the qPCR, the volume transferred into the wells, the extraction from soil, and the factor from the reverse transcription, the number of viruses in the initial soil sample can be calculated.
Now that you know how qPCR is performed, let’s look at how it can be used to analyze different environmental samples.
qPCR can be used to quantify the amount of viruses recovered from many different types of samples. In this application, two different kinds of adenoviruses were concentrated from water samples by a number of different methods. DNA was then extracted from the viruses and subjected to qPCR, to evaluate the relative efficiency of the concentration methods.
Another application for qPCR-based microbial enumeration is to quantify bacterial content in food and agricultural samples – in this example, fecal and litter samples from chicken farms. Rather than targeting individual species, the scientists performed qPCR using primers against a highly conserved gene found in all bacteria and quantified the total bacterial community found in the samples.
Finally, as mentioned earlier, one disadvantage of traditional qPCR methodology is that live and dead microbes cannot be distinguished. However, by adding a chemical known as propidium monoazide, or PMA, which can only enter dead cells where it binds to DNA to inhibit subsequent enzymatic reactions such as PCR, researchers here were able to distinguish between live and dead cultures of E. coli O157:H7, a common pathogenic strain found in contaminated food and water.
You’ve just watched JoVE’s introduction to quantifying environmental microorganisms and viruses using qPCR. You should now understand how qPCR works, how to use qPCR to measure the amount of a microbe in an environmental sample, and some applications of this technique. Thanks for watching!
