Hairy Root Transformation and Regeneration in Arabidopsis thaliana and Brassica napus

1. Preparation of media and solutions

1. Prepare the hormone stock solutions.
   1. For preparation of 50 mL of 1-naphthaleneacetic acid (NAA), 6-benzylaminopurine (BAP), and indole-3-butyric acid (IBA) stock solution with a concentration of 5 mg/mL, dissolve 250 mg of the powdered hormone in 2 mL of 1 M sodium hydroxide (NaOH) and adjust the volume to 50 mL with ultrapure water.
   2. To prepare 50 mL of gibberellic acid (GA₃) with a concentration of 1 mg/mL, dissolve 50 mg of the powdered hormone in 2 mL of ethanol and adjust the volume to 50 mL of ultrapure water.
   3. Filter the solution using a sterile syringe filter with 0.22 µm pore size and distribute it into sterile 2 mL tubes for storage. Store the solution at -20 °C or 4 °C, depending on the manufacturer's recommendation.
2. Prepare antibiotic stock solutions. For 50 mL of cefotaxime and ticarcillin disodium stock solution with a concentration of 100 mg/mL, dissolve 0.5 g of the powdered antibiotic in 40 mL of ultrapure water and adjust to a final volume of 50 mL. Filter the solution using a sterile syringe filter with 0.22 µm pore size and distribute it into sterile 2 mL tubes for storage. Store the solution at -20 °C.
   NOTE: Antibiotics and hormones are always added to the cooled medium.
3. Prepare 1 L of Luria Broth (LB) medium by adding 10 g of bacto-tryptone, 5 g of yeast extract, and 5 g of sodium chloride (NaCl) in a 1 L measuring cylinder and adjust the volume to 1 L with double distilled water. Adjust the pH to 7.0 with KOH with a pH meter (following the manufacturer's instructions). Transfer the solution to a 1 L bottle and add 15 g of bacteriological agar (1.5%), if a solid medium is prepared and autoclave the medium. If necessary, add the appropriate antibiotics (bacterial resistance is carried on the binary vector) to the cooled medium.
   NOTE: Use an autoclave to sterilize the solution. Put the bottle into the basket, close the lid, and sterilize it for 20 min at 121 °C and 98.9 kPa. This protocol is always used for autoclaving solutions in further steps.
4. Prepare 1 L of Yeast Extract Beef (YEB) medium by mixing 5 g of beef extract, 1 g of yeast extract, 5 g of peptone, 5 g of sucrose, and 0.5 g of magnesium chloride (MgCl₂) into double distilled water. Adjust the volume to 1 L. Transfer the solution to a 1 L bottle. Autoclave the medium.
5. Prepare 1 L of medium for seed germination by mixing 2.2 g of Murashige and Skoog (MS) powder, 10 g of sucrose (1%), and 0.5 g of 2-(N-Morpholino)ethanesulfonic acid (MES) sodium salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH. Transfer the solution to a 1 L bottle and add 8 g of plant agar (0.8%). Autoclave the medium.
6. Prepare 1 L of plant growth medium by mixing 2.2 g of MS powder, 5 g of sucrose (0.5%), and 0.5 g of MES salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH. Transfer the solution to a 1 L bottle and add 8 g of plant agar (0.8 %). Autoclave the medium.
7. Prepare 1 L of hairy root growth medium by mixing 4.4 g of MS + B5 vitamins powder, 30 g of sucrose (3%), and 0.5 g of MES salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH, and transfer the solution to a 1 L bottle. Add 3 g of gelling agent (0.3%) and autoclave the medium. Add cefotaxime and ticarcillin disodium to a final concentration of 100 – 200 mg/L and 100 – 500 mg/L, respectively. If necessary, add the appropriate antibiotics (resistance is due to the T-DNA of a binary vector).
8. Prepare 1 L of composite plant growth medium by mixing 2.2 g of MS + B5 vitamins powder, 10 g of sucrose (1%), and 0.5 g of MES salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH and transfer the solution to a 1 L bottle. Add 6 g of gelling agent (0.6%) and autoclave the medium. Add cefotaxime and ticarcillin disodium to a final concentration of 200 mg/L and 500 mg/L, respectively. If necessary, add the appropriate antibiotics (resistance is due to the T-DNA of a binary vector).
9. Prepare 1 L of regeneration medium by mixing 4.4 g of MS + B5 vitamins powder, 30 g of sucrose (3%), and 0.5 g of MES salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH. Transfer the solution to a 1 L bottle and add 3 g of gelling agent (0.3 %). Autoclave the medium. Add NAA and BAP to a final concentration of 8 mg/L and 5 mg/L, respectively, and ticarcillin disodium to a final concentration of 100 mg/L.
10. Prepare 1 L of shoot elongation medium by mixing 4.4 g of MS + B5 vitamins powder, 20 g of sucrose (2%), and 0.5 g of MES salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH. Transfer the solution to a 1 L bottle and add 3 g of plant agar (0.3%). Autoclave the medium. Add BAP and GA₃ to a final concentration of 0.5 mg/L and 0.03 mg/L, respectively, and cefotaxime to a final concentration of 100 mg/L.
11. Prepare 1 L of root induction medium by mixing 2.2 g of MS + B5 vitamins powder, 10 g of sucrose (1%), and 0.5 g of MES salts into double distilled water. Adjust the volume to 1 L, mix, and adjust the pH to 5.8 with KOH. Transfer the solution to a 1 L bottle and add 3 g of gelling agent (0.3%). Autoclave the medium. Add IBA and cefotaxime to a final concentration of 0.5 mg/L and 100 mg/L, respectively.
12. Prepare 1 L of Cetyltrimethylammonium bromide (CTAB) buffer by adding 20 g of CTAB (2% w/v final), 100 mL of 1M Tris-HCl, pH 8.0 (100 mM final), 40 mL of 0.5 M EDTA, pH 8.0 (20 mM final), 81.8 g of NaCl (1.4 M final) and 5 g of PVP40 (0.5% w/v final). Adjust to 1 L with double distilled water. Autoclave the solution. Store the solution for up to 1 year at room temperature.

2. Transformation of Agrobacterium with a binary vector

1. Prepare the DNA of a verified binary plasmid containing the T-DNA cassette to be integrated into the plant genome. Ensure that the plasmid DNA contains low salts to avoid electric sparks as electroporation is used. Using a plasmid DNA extraction kit of choice is recommended.
2. Prepare electrocompetent Agrobacterium tumefaciens C58C1 cells containing the hairy-root-inducing plasmid pRiA4b by inoculating 200 mL of liquid pre-heated (28 °C) YEB with 8 mL of a fresh overnight culture. Incubate culture at 28 °C while shaking until the optical density at 600 nm (OD₆₀₀) is about 0.5, corresponding to the mid-log phase. It takes about 4 – 5 h.
3. Divide the Agrobacterium culture into four pre-chilled sterile 50 mL centrifuge tubes. Centrifuge for 15 min at 4 °C at 3,200 x g.
   NOTE: The cells should be kept cold from this step onward.
4. Remove the supernatant and resuspend the pellet gently in (4x) 2.5 mL of cold (4 °C) 10% glycerol. Add another 47.5 mL of cold 10% glycerol and gently mix.
5. Pellet cells at 3,200 x g for 15 min at 4 °C. Discard supernatant and resuspend cells in (4x) 10 mL of cold 10% glycerol.
6. Pellet the cells again and resuspend them in (4x) 0.75 mL of cold 10% glycerol. Pool the content of all four tubes into one (total volume = 3 mL).
7. Divide the agrobacterial solution into 50 μL aliquots in pre-chilled sterile 1.5 mL microtubes. Freeze the aliquots on dry ice or liquid nitrogen. Store the tubes at -80 °C for future use.
8. Place one tube of competent cells (50 μL) on ice, mix with 5 μL of plasmid DNA (1 μg in total, from step 2.1), transfer the mixture to an electroporation cuvette (0.2 cm gap), and incubate for 5 min on ice.
9. Place the cuvette in the electroporator and electroporate the cells with the following settings: capacitance 25 µFD, resistance 400 Ω, electrical voltage 2.5 kV, pulse duration 9.7 ms.
10. Add 950 µL of LB liquid medium to the cells, which are then cultured at 28 °C for 2 h at 300 rpm in a thermomixer. Plate 50 µL of the cell culture onto a solid LB medium with the appropriate selective antibiotic. Culture the plates for 2 days at 28 °C.
    NOTE: It is recommended to plate a range of cell cultures (10 µL – 100 µL) per plate to determine a proper culture volume and avoid overgrowth of bacteria.
11. Prepare liquid cultures from a few selected colonies in 5 mL of LB liquid medium with antibiotics. Grow the bacteria overnight at 28 °C with shaking. Use these cultures for glycerol stocks by mixing 0.5 mL of liquid bacteria culture and 0.5 mL of 40% glycerol.
    ​NOTE: These colonies are verified for the presence of the transgene by colony PCR. For this purpose, add a small amount of a colony from a plate to the PCR master mix containing buffer, dNTP, and Taq polymerase of choice, together with primers amplifying a part of the T-DNA from a binary vector. Inoculum from the glycerol stocks is used for the transformation of the plants.

3. Hairy root transformation of Brassica napus DH12075

1. Place seeds of Brassica napus DH12075 in microtubes and sterilize them in a flow box. First, degrease the seeds using water and 0.1% detergent while shaking for 60 s. Then, rinse the seeds with water followed by 70% ethanol, both for 60 s.
2. Sterilize the seeds using a 10% solution of commercial bleach containing sodium hypochlorite. Shake the seeds in this solution for 20 min.
3. Wash the seeds 4x with sterile water for 60 s each. Place them on Petri dishes containing the seed germination medium. Cold-stratify the seeds at 4 °C overnight and move the plates to a cultivation room (21 °C, 16 h light /8 h dark).
4. Transfer 5-day-old seedlings to plant culture boxes containing a plant growth medium .
   NOTE: The best transformation efficiency in DH12075 was identified for 18-day-old seedlings. The seedling age may be optimized for the local growth conditions or other cultivars.
5. Inoculate a liquid culture of Agrobacterium tumefaciens C58C1 carrying a hairy root-inducing plasmid pRiA4b and the binary vector for transformation (from step 2.11) with an inoculation loop. Use 5 mL of LB medium. Grow this culture overnight at 28 °C until it reaches OD₆₀₀ = 0.9 – 1.
   NOTE: Agrobacterium containing only the Ri plasmid is used if wild-type hairy roots are produced.
6. Inject a small amount of culture (approximately 50 µL) with an insulin syringe into the hypocotyl of an 18-day-old seedling (from step 3.4.). Puncture the hypocotyl through with a 26G needle mounted on the syringe at about 1 cm above the surface of the medium. Inject the liquid into the wound. The tissue on the surface of the hypocotyl can also be scratched by the syringe.
   NOTE: The number of inoculated seedlings must be adapted to the experimenter's needs.
7. Return the plants to the cultivation room at 21 °C for 2-to-4 weeks until a callus and hairy roots are formed at the wounding site.
8. Cut off the callus with the emerged hairy roots from the hypocotyl and place it on a Petri dish with the hairy root growth medium containing selective antibiotics (carried by the T-DNA) and cefotaxime (200 mg/L) and ticarcillin (500 mg/L) to suppress agrobacterial growth. Seal the Petri dishes with gas-permeable tape. Culture the hairy roots at 24 °C in the dark.
   NOTE: Proper concentration of specific antibiotics used for functional selection must be tested with wild-type hairy roots. For B. napus DH12075 hairy roots carrying resistance to kanamycin, a concentration of 25 mg/L kanamycin is used.
   NOTE: In this step, it is possible to generate a composite plant consisting of the wild-type shoot and transgenic hairy roots supporting the growth of such plant. Instead of cutting off the hairy roots from a stem, the native roots of the plant are removed. The plant with emerging hairy roots is transferred to a plant culture box with a composite plant growth medium containing cefotaxime (200 mg/L) and ticarcillin (500 mg/L) to suppress agrobacterial growth, and the selective antibiotic (carried by the T-DNA).
9. After 1 – 2 weeks, isolate the hairy roots on the Petri dish from the callus and individualize them on plates with the same culture medium. Transfer the culture to a fresh plate every 4 to 5 weeks. Add 0.25 mg/L IBA to increase root branching.
10. Reduce the concentrations of cefotaxime and ticarcillin gradually at each transfer by 100 mg/L (i.e., the medium for the first transfer contains 100 mg/L cefotaxime and 400 mg/L ticarcillin; for the second transfer, 300 mg/L ticarcillin, etc.). After 3 – 4 months, culture the hairy roots on a hairy root growth medium with 100 mg/L ticarcillin and the selective antibiotic.

4. Regeneration of Brassica napus DH12075 hairy roots

1. Transfer independent hairy root lines to plates with regeneration medium in sterile conditions using tweezers, flamed before use. Transfer 5 – 10 roots per Petri dish and culture them at 21 °C in a long-day photoperiod (16 h light / 8 h dark). Seal the Petri dishes with gas-permeable tape.
2. Every 3 to 4 weeks, transfer the hairy roots to plates with fresh regeneration medium. Note that calli are formed after approximately 2 weeks. The callus starts shooting after 2 more weeks to till 8 – 9 weeks after callus formation.
3. Individualize the shoots and transfer them to plant culture boxes with shoot elongation medium for 2 to 3 weeks to promote the elongation of the shoots.
4. Transfer the elongated shoots to plant culture boxes with a root induction medium. Refresh the culture every 3 – 4 weeks. The rooting efficiency in DH12075 is 87% at 30 days and up to 100% after 60 days.
5. Transfer the rooted plants to the soil after removing any traces of gelling agent to prevent fungal infection. Ensure that the plants are first acclimated in the phytotrons (21 °C, long-day photoperiod, 150 µE) and then transfer them to a greenhouse for flowering (21 °C / 18 °C, long-day photoperiod, 150 µE).

5. Regenerant and T1 plant selection

NOTE: The hairy root lines can be selected before going into the regeneration process. The type of selection depends on the content carried by the transgene. The hairy roots can be sampled for DNA extraction and genotyping or mutation detection, RNA extraction with subsequent cDNA synthesis and RT-qPCR for expression level analysis of the gene of choice, microscopy for fluorescence detection, or treated for GUS staining.

1. After transfer to soil, genotype the T0 regenerant plants (and T1 seedlings) again to avoid escapes from the selection procedures. T0 plants exhibit an altered phenotype called Ri phenotype: extensive root growth, curly leaves, and dwarf shoots caused by the presence of the TL and/or TR-DNA of the Ri plasmid inserted into the plant genome.
2. To speed up the T1 selection, use the seeds containing green mature embryos (approx. 21 – 28 days after pollination for DH12075 for a torpedo embryo or older) from T0 regenerant plants for embryo rescue.
   1. Work in the sterile flow box. Collect the siliques and surface-sterilize them with 70% ethanol.
   2. Place them on a double-sided tape taped on a plate lid or a slide.
   3. Using a stereo-binocular, slit the silique along the valve margins using a 26G needle. Ensure that the cut does not damage the seeds. For easy grip, mount the needle on a 1 mL syringe.
   4. Open the carpels and stick them to the tape. Collect the immature seeds and transfer them to plates with medium for seed germination. Seal the plates with gas-permeable tape.
   5. Place the plates in a cultivation room (21 °C, 16 h light /8 h dark) until germination.
3. Genotype the T1 seedlings for the presence of the transgene of interest and the absence of the Ri TR/TL (Figure 1). Collect leaf material and extract their DNA using the method of choice. The CTAB method is described here:
   1. Collect the leaf material into a 2 mL microtube containing two ceramic beads. Freeze the tube in liquid nitrogen.
   2. Grind the material using a ball mill. Alternatively, pestle and mortar may be used.
   3. After a quick spin down, add 400 µL of CTAB buffer to the powder. Vortex briefly, spin down, and incubate at 60 °C for at least 50 min.
   4. Cool the solution to room temperature for 15 min. Add one volume of chloroform and mix gently.
      ​CAUTION: When using chloroform, work under the chemical flow and use gloves for protection. Any solution containing chloroform should be discarded in the appropriate waste bin.
   5. Centrifuge for 5 min at 18,400 x g using a tabletop centrifuge. Transfer 250 – 350 µL of the upper aqueous phase to a new microtube. Omit the interphase.
   6. Add one volume of isopropanol, mix well, and incubate for 5 min at room temperature. Centrifuge for 40 min at 18,400 x g.
   7. Discard the liquid and add 200 µL of 70% ethanol. Wash the pellet and centrifuge for 15 min at 18,400 x g.
   8. Discard the liquid. Air dry the pellet and add 50 – 100 µL of ultrapure water. Let the DNA dissolve for 1 h to overnight in the fridge.
4. Perform a genotyping by PCR for the rolA gene (TL), the aux1 gene (TR), and the virC locus (Agrobacterium). Prepare the PCR reaction using the prepared DNA (from step 5.3.), primers, buffer, dNTP, and Taq polymerase according to the manufacturer's protocol. The amplified fragments are 200 – 500 bp long.
   Primers specific for rolA:
   Forward: GTTAGGCGTGCAAAGGCCAAG
   Reverse: TGCGTATTAATCCCGTAGGTC
   Primers specific for aux1:
   Forward: CATAGGATCGCCTCACAGGT
   Reverse: CGTTGCTTGATGTCAGGAGA
   Primers specific for virC:
   Forward: AATGCGTCTCTCTCGTGCAT
   Reverse: AAACCGACCACTAACGCGAT
   NOTE: T-DNA transfer and integration might be partial, and only parts of TL and/or TR may integrate into the genome. Thus, it is recommended to analyze the presence of other ORFs of TL (e.g., rolB and rolC) and TR (aux2, mas1, ags1) in T1 seedlings. Primer sequences specific to these loci are listed in Jedličková et al.⁹.
5. Evaluate PCR reactions by gel electrophoresis.
   NOTE: Including a positive control in this analysis is recommended to ensure having PCR-grade DNA.
6. Select for the presence (or absence) of the transgene according to the protocols based on the content of this transgene.
7. Transfer selected seedlings to the soil.

6. Hairy root transformation and regeneration in Arabidopsis thaliana Col-0

1. Surface-sterilize A. thaliana seeds with a method of choice (bleach, ethanol, or chlorine gas).
2. Plate sterile seeds on a medium for seed germination. After 2 days of cold stratification, move the plates to a cultivation room (21 °C with long-day photoperiod and 50% humidity).
3. Transfer 1-week-old seedlings to a plant culture box with plant growth medium.
4. Prepare Agrobacterium cultures as indicated in step 3.5.
5. Inject a small amount of culture (approximately 50 µL) with a needle mounted on an insulin syringe at the base of the primary inflorescence stem (approximately 1 – 2 cm above the rosette) of 1-month-old Arabidopsis plantlets. The tissue on the surface of the primary stem can also be scratched by the syringe.
6. At 2-4 weeks after the injection, excise the emerging hairy roots and cultivate them on Petri dishes with the hairy root growth medium supplemented with the selective antibiotic (carried by the T-DNA) and cefotaxime (200 mg/L) and ticarcillin (500 mg/L) to suppress agrobacterial growth. Incubate the plates at 24 °C in the dark.
7. After 1 – 2 weeks, individualize the hairy roots on plates with the same culture medium. Transfer the selected hairy root lines to a fresh medium every 4 – 5 weeks.
   NOTE: A. thaliana hairy roots are thinner than those of B. napus, and caution must be taken when transferring to fresh media.
8. Transfer the hairy roots to plates with regeneration medium to induce callus formation. Culture the plates at 21 °C in a long-day photoperiod (16 h light / 8 h dark).
9. Shoots emerge from the callus after 18 – 21 days of cultivation. Cut the shoots and transfer them to a shoot elongation medium for 2 – 3 weeks to promote growth and elongation.
10. Transfer the elongated shoots to the root induction medium.
11. Transfer the rooted plants to the soil. T0 plants also present a Ri phenotype. Perform the transgenic selection, as described for B. napus DH12075 (step 5).