Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

All mouse experiments were performed in compliance, and with approval from, the University of Kansas Medical Center Institutional Animal Care and Use Committee. All healthy human blood samples were obtained under informed consent and with approval from the Institutional Review Board at the University of Kansas Medical Center.

1. Irradiation of NSG Mice

1. One day prior to PBMC injection, irradiate 8–12-week old NSG mice (either sex can be used). In a sterile biosafety cabinet, place mice in a sterilized pie cage or microisolator. Irradiate mice in a Cs¹³⁷ source or small animal irradiator (e.g., RS 2000) with a total dose of 150 cGy with slow rotation to ensure even irradiation.
2. Place mice into clean cages in a sterile biosafety cabinet.

2. Preparation of human PBMC for injection

1. Collect enough healthy human blood to isolate 1.1 x 10⁷ PBMC per mouse. Dilute the heparinized blood in an equal volume of 2% fetal bovine serum (FBS) in phosphate buffered saline (PBS).
   NOTE: With this protocol, the PMBC yield is generally 0.5–1 x 10⁷ per 10 mL of whole blood. Each mouse will receive 10⁷ PBMC in 100 µL of PBS. The extra 1 x 10⁶ in 10 µL per mouse ensures that each mouse receives the full dosage of PBMC, should there be any issues with filling syringes.
2. Add 15 mL lymphocyte separation density gradient medium (e.g., Ficoll) to a 50 mL conical tube and then carefully overlay up to 25 mL of diluted blood on top of the density gradient. Centrifuge the tube containing density gradient and diluted blood at 400 x g for 40 min at room temperature without brake.
3. Harvest the PBMC interface into 10 mL of PBS in a 50 mL conical tube. Centrifuge the cells at 400 x g for 10 min. Remove the supernatant.
4. Loosen pellet by flicking tube and resuspend in 10 mL PBS to wash the PBMC. Centrifuge the cells at 400 x g for 5 min.
5. (Optional) Discard the supernatant and lyse red blood cells (RBCs) in the cell pellet by adding a volume of Ammonium-Chloride-Potassium (ACK) lysis buffer that is equal to the pellet volume. Gently resuspend the pellet and swirl the tube for 30–60 s. Fill tube with serum-free RPMI media and centrifuge the tube at 400 x g for 5 min.
6. Remove the supernatant and re-suspend the cell pellet in 5 mL of PBS. Count the cells using trypan blue exclusion with a hemocytometer and a microscope.
7. Centrifuge the cells at 400 x g for 5 min. Remove the supernatant and resuspend cells at 1 x 10⁸ cells/mL in PBS.

3. Retro-orbital injection of human PBMC into mice²¹

1. Place an anesthesia chamber in a laminar flow hood to maintain sterility. Pre-charge the anesthesia chamber with 5% isoflurane and 1 L/min oxygen flow rate for 5 min.
2. Reduce isoflurane to 2% and put mice from the same cage into the anesthesia chamber. Once mice lose righting, anesthetize mice for 5 min in chamber. During this time, pre-fill syringe with 100 µL (1 x 10⁷ cells) of cell suspension.
3. Place mouse on a heating pad with its nose in a nose cone to maintain anesthesia. Check for loss of consciousness by pinching a foot pad and checking for lack of reflex.
4. Restrain mouse with the thumb and middle finger. Insert the 28 G 1/2 in needle with the bevel down lateral to the medial canthus, through the conjunctival membrane until the back of the eye is reached. Slightly retract the needle and slowly inject 100 μL of cells (1 x 10⁷ cells).
5. Fully retract the needle and properly dispose of the syringe and needle. Close the eyelid and apply mild pressure to the injection site with a gauze sponge.
6. Examine the injection site for swelling or other visible trauma. Allow the mouse to regain consciousness in a sterile cage lined with paper towels to prevent aspiration of bedding before moving to home cage. After any bleeding has stopped, apply a single drop of proparacaine to the eye for analgesia.
   NOTE: Tail vein injection is an alternative method of intravenous injection of PBMC for this protocol as described by Macholz et al.²².

4. Clinical Scoring of acute GVHD in Mice (Figure 1)²³

1. Measure GVHD score every other day until mice reach a score of a 2 and then every day until day of sacrifice.
   1. Place the cage in a laminar flow hood, remove the food and water and put the lid back on. Score activity by observing mice for 5 min and assign scores as follows: 0 = mouse starts walking within a couple minutes and keeps walking around cage, 1 = mouse takes a more than a couple minutes to get up and walks slowly around cage, 2 = mouse doesn’t get up in 5 min and only walks when touched.
2. Weigh each mouse in a glass beaker and give a weight loss score: 0 = <10% change, 1 = 10–25% change and 2 = >25% change.
3. While the mouse is still in the beaker, inspect for posture: 0 = normal, 1 = hunching at rest, 2 = hunching impairs movement; fur texture: 0 = normal, 1 = mild to moderate ruffling, 2 = severe ruffling, and skin integrity : 0 = normal, 1 = scaling of paws/tail, 2 = obvious areas of denuded skin (look at ears, tail and paws for scaling).
4. With five categories and a score of 0–2 for each category, a mouse can reach a maximum score of 10. When a mouse reaches a score of 7 or greater or reaches 42 days post-injection, euthanize mouse via CO₂ euthanasia or other method approved by the local Institutional Animal Care and Use Committee.
   NOTE: To ensure accuracy of results, the scoring is performed by a researcher who is blinded to the treatment groups²⁴. Additionally, although >20% of body weight loss is the recommended humane endpoint for many IACUC protocols, with additional justification IACUC approval of this protocol can be obtained.

5. Harvesting tissues for genomic DNA from euthanized mice and isolating genomic DNA

1. Dissect mice using sterile surgical tools. Cut a small piece of tissue about 3 mm x 0.5 mm in size from an organ of interest, e.g., lung, liver, or spleen. Weigh the tissue sample and place the tissue piece in a sterile 1.5 mL tube. If collecting multiple tissues, wash tools with ethanol between cutting each organ.
2. Freeze tissues by submerging the tubes containing the tissue in liquid nitrogen until it stops bubbling and store in -80 °C overnight. Thaw the tissue samples and lyse them according to a genomic DNA (gDNA) isolation kit.
3. Isolate genomic DNA according to manufacturer’s instructions as described in the kit. Be sure to note the amount of tissue that was processed per microliter of eluted gDNA (mg/μL).
   NOTE: Frozen tissues can be stored at -80 °C for processing at a later time.

6. Quantification of human T cells using digital PCR (Figure 2)

1. Prepare digital PCR reactions according to the protocol for DNA binding dyes for the digital PCR machine being used. Use the following primers specific for human CD3 epsilon genomic DNA (NCBI Reference Sequence: NG_007383.1); Forward Primer: AGGCTGCCTTAACTCCCAAG, Reverse Primer: GCCCTACCAGCTGTGGAAAC. These primers will yield a single band of 105 bp.
   NOTE: Add 0.5 μL of a restriction enzyme, such as HindIII, to each reaction to digest the genomic DNA. Be sure to test out different gDNA dilutions to optimize separation of positive and negative droplets. Additionally, a subset of infiltrating T cells may be non-pathogenic regulatory T cells. These cells can be quantified using additional primers for regulatory T cell markers.
2. Carry out the digital PCR reaction under the following conditions: Lid at 105 °C, 95 °C for 10 min (1 cycle); 95 °C for 30 s, ramp 2 °C/s and 55 °C for 1 min, ramp 2 °C/s (40 cycles); 72 °C for 10 min, 12 °C hold.
   NOTE: These parameters may need to be adjusted depending on digital PCR equipment.
3. Acquire digital PCR data with analysis software. Report data as numbers of copies per mg of tissue using the following equation: (number of copies/μL) x (μL of gDNA in reaction) x (dilution factor)/(mg of tissue/μL of total gDNA )