Genome-wide Snapshot of Chromatin Regulators and States in Xenopus Embryos by ChIP-Seq

NOTE: All Xenopus work complies fully with the UK Animals (Scientific Procedures) Act 1986 as implemented by the MRC National Institute for Medical Research.

1. Preparations

1. Estimate the number of embryos required for the ChIP experiment (see discussion).
2. Prepare the following solutions which are stored at RT: 500 ml of 10x Marc’s Modified Ringers (MMR) without EDTA, pH adjusted to 7.5 and sterilized by autoclaving (1 M NaCl, 20 mM KCl, 20 mM CaCl₂, 10 mM MgSO₄, 50 mM HEPES pH 7.5)¹⁰, 1 ml of SDS elution buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% SDS) and 1 ml of 5x DNA loading buffer (0.2% Orange G, 30% glycerol, 60 mM EDTA pH 8.0).
3. Prepare the following solutions which are stored at 4 °C: 50 ml of HEG buffer (50 mM HEPES–KOH pH 7.5, 1 mM EDTA pH 8.0, 20% glycerol), 500 ml of extraction buffers E1 (50 mM HEPES-KOH pH 7.5, 150 mM NaCl, 1 mM EDTA. 10% glycerol, 0.5% Igepal CA-630, 0.25% Triton X-100), E2 (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 0.5 mM EGTA), and E3 (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% Igepal CA-630, 0.25% Na-Deoxycholate, 0.1% SDS), 500 ml of RIPA buffer (50 mM HEPES-KOH pH 7.5, 500 mM LiCl, 1 mM EDTA, 1% Igepal CA-630, 0.7% Na-deoxycholate) and 50 ml of TEN buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 150 mM NaCl).
4. Score and clip a 15 ml conical polystyrene tube at the 7 ml mark. Use this tube to contain nuclear extracts undergoing sonication.
5. For post-sequencing analysis, use a multicore Unix-style operating computer with at least 8 GB RAM and 500 GB free disk space. Install the following software locally of which most are used at the command line: FastQC, Illumina CASAVA-1.8 quality filter, Bowtie¹¹, SAMtools¹², HOMER¹³, MACS2¹⁴, IGV^15,16, Cluster3¹⁷, Java TreeView, BLAST+¹⁸, and b2g4pipe¹⁹. Check the installation instructions and requirements for compilers and third party software.
6. Build a Bowtie index for aligning short NGS reads to the Xenopus genome. An example is shown here for the X. tropicalis genome v7.1 (November 2011), which can be downloaded as a FASTA file (genome.fa) from the Xenbase ftp server (/pub/Genomics/JGI). Move the FASTA file to the index subdirectory of Bowtie.
   1. Use the following command line (here after the prompt character >) to generate xenTro7 index files:
      > bowtie-build /path/to/bowtie/index/genome.fa xenTro7
      > export BOWTIE_INDEXES=/path/to/bowtie/index/
7. Download the gene annotation file (GTF) from the UCSC Genome Browser or the mirror site on the NIMR server for latest genome versions (genomes.nimr.mrc.ac.uk) via Tools/Table Browser. Use the genome FASTA file and the GTF file to customize HOMER for Xenopus (e.g., X. tropicalis genome v7.1, –name xenTro7).
   1. Alternatively, use pre-built HOMER packages for some older versions of the Xenopus genome.
      > loadGenome.pl -name xenTro7 -org null -fasta /path/to/genome.fa -gtf path/to/genes.gtf
8. Create a genome track (.genome file) for the genome browser IGV by uploading an indexed FASTA file (genome.fa with genome.fa.fai file in the same folder) and the annotation file (genes.gtf). Create a genome scaffold index (genome.fa.fai) for the Xenopus genome as follows:
   > samtools faidx /path/to/genome.fa
9. Use BLAST+ to pass Gene Ontology (GO) terms from several model species (human, mouse, zebrafish, fruit fly and yeast) onto Xenopus genes as follows:
   1. Download all coding sequences (CDS) as a single FASTA file (cds.fa) from the UCSC Genome Browser via Tools/Table Browser and update BLAST+ with the pre-formatted BLAST database of non-redundant proteins (nr):
      > update_blastdb.pl nr
   2. Search for human (txid9606), mouse (txid10090), zebrafish (txid7955), fruit fly (txid7227) and yeast (txid4932) proteins from the NCBI site via its advanced search function (http://www.ncbi.nlm.nih.gov/protein/advanced) and send the resultant GI (sequence identifier) list (sequence.gi.txt) to the computer.
   3. Assign Xenopus genes to the most similar proteins from the GI list by executing BLASTx with a certain expect (E) value cutoff (here 10^-20). Make sure the output format is xml (-outfmt 5 -out blastx_results.xml). Make use of time-saving threads (-num_threads) which correlate with the number of available computer cores.
      > blastx -db /path/to/nr -gilist /path/to/sequence.gi.txt -query /path/to/cds.fa -evalue 1e-20
      -outfmt 5 -out /path/to/blastx_results.xml -num_threads [# threads]
   4. Open the b2gPipe.properties file of the b2g4pipe folder with a text editor and update the database properties to Dbacces.dbname=b2go_sep13 and Dbacces.dbhost=publicdb.blast2go.com. Run b2g4pipe from the installation folder.
      > java Xmx1000m -cp *:ext/*: es.blast2go.prog.B2GAnnotPipe -in /path/to/blastx_results.xml
      -out results/xenTro7 -prop b2gPipe.properties -v -annot
      NOTE: This program extracts GO terms for each BLAST hit and assigns them to corresponding Xenopus genes (xenTro7.annot). The most updated database settings can be found under Tools/General Settings/DataAccess Settings of the Blast2GO Java Web Start application (see 9.11.1).

2. Chromatin Cross-linking

1. Fertilize Xenopus eggs, de-jelly and culture embryos according to standard protocols²⁰.
2. Transfer the dejellied embryos (maximum 2,500 X. laevis or 10,000 X. tropicalis) at the developmental stage of interest to an 8 ml glass sample vial with cap and wash them briefly once with 0.01x MMR.
3. Fix the embryos with 1% formaldehyde in 0.01x MMR (e.g., add 225 µl of 36.5-38% formaldehyde to 8 ml 0.01x MMR) for 15 to 40 min at RT (see Discussion for the fixation time and the number of embryos required per ChIP experiment).
   NOTE: Formaldehyde is corrosive and highly toxic. It is hazardous in case of eye and skin contact, indigestion, and inhalation. Use the fume hood when adding formaldehyde to the vial.
4. Stop the fixation by briefly washing the embryos three times with cold 0.01x MMR. Do not let embryos make contact with the liquid surface because surface tension causes them to rupture.
5. Aliquot the embryos into 2 ml microcentrifuge tubes on ice with a maximum of 250 embryos per tube, which occupy a volume of approximately 250 µl (X. tropicalis) or 600 µl (X. laevis) before hatching.
6. Pipette away as much 0.01x MMR as possible. Skip the following step if you continue immediately with section 3.
7. Equilibrate embryos in 250 µl of cold HEG buffer. Once the embryos have settled to the bottom of the tube remove as much liquid as possible and snap-freeze in liquid nitrogen. Store at -80 °C.

3. Chromatin Extraction

NOTE: The following extraction of cross-linked chromatin from Xenopus embryos works most efficiently with the fixation times indicated in step 2.3 and 50 to 80 X. tropicalis or 25 to 40 X. laevis embryos per ml of extraction buffer E1, E2 and E3. Each extraction step is repeated, so that twice the calculated volume of buffer is required. For upscaling, use multiple 2 ml microcentrifuge tubes or 50 ml centrifuge tubes. Keep samples and buffers on ice during the chromatin extraction.

1. Supplement adequate volumes of buffers E1, E2 and E3 with 1 mM DTT and protease inhibitor tablets. If performing ChIP with a phospho-specific antibody, further supplement buffers with 5 mM NaF and 2 mM Na₃VO₄.
2. Homogenize fixed embryos with E1 by pipetting up and down. Centrifuge homogenates in a refrigerated centrifuge (4 °C) at 1,000 x g for 2 min (or 5 min in case of using 50 ml tubes). Aspirate the supernatant and any lipids attached to the wall.
3. Resuspend pellets in E1. Keep samples on ice for 10 min. Centrifuge and discard supernatants as in step 3.2.
4. Resuspend pellets in E2. Centrifuge and discard supernatants as in step 3.2.
5. Repeat step 3.4, but keep samples on ice for 10 min before centrifugation.
6. Resuspend pellets in E3. Keep samples on ice for at least 10 min. Centrifuge and discard supernatants as in step 3.2.
   NOTE: At this stage, the resuspensions should become fairly transparent. The anionic detergents in E3 extract cross-linked nuclei by rendering most of the remaining yolk platelets soluble.
7. Resuspend and pool pellets of cross-linked nuclei (normally colored brown from the insolubilized pigment granules) in a total volume of 1 ml of E3. Dilute sample with E3 to 2 or 3 ml if it appears very viscous and is difficult to pipette. Keep on ice or at 4 °C to proceed with step 4 on the same or following day. Snap-freeze in liquid nitrogen and store at −80 °C for later use.

4. Chromatin Fragmentation

NOTE: Sonication is used both to solubilize and to shear cross-linked chromatin. Here are parameters to run the Misonix Sonicator 3000 equipped with a 1/16 inch tapered microtip and sound enclosure. If using other sonicators, follow the manufacturers’ recommendations to shear cross-linked chromatin or use 6 to 12 W for 4 to 8 min in total.

1. Transfer the nuclear sample from step 3.7 into a custom-built tube for sonication (step 1.4). Keep the sample chilled during sonication by having the tube attached to an 800 ml plastic beaker filled with ice water via a short thermometer clamp.
2. Place the beaker on a laboratory jack. Adjust the jack so that the sonicator microtip is submersed in the sample to about two-thirds of the volume depth and centered without touching the tube wall.
3. Sonicate the sample for 7 min in total, interrupted every 30 sec with 1 min pauses. Set power to 1.0. Start the sonication and immediately increase the power setting (normally 2 to 4) to reach a reading of 9 to 12 W. Pause immediately if the sample begins to froth. Reposition tube and restart when the froth has completely disappeared.
4. Transfer the sheared chromatin into pre-chilled 1.5 ml microcentrifuge tubes and spin at full speed (>15,000 x g) for 5 min at 4 °C.
5. Transfer the supernatant to pre-chilled 1.5 ml microcentrifuge tubes. Collect 50 µl of the supernatant (ideally containing the chromatin of around 400,000 or more nuclei) to visualize the degree of chromatin fragmentation (section 5). Use the rest of the supernatant for ChIP (section 6).
6. Store samples at 4 °C for up to one day. Snap-freeze samples as aliquots (one per ChIP experiment) in liquid nitrogen for long-term storage at -80 °C.

5. Imaging Chromatin Fragmentation

1. Add 50 µl of SDS elution buffer, 4 µl of 5 M NaCl and 1 µl of proteinase K (20 μg/μl) to 50 µl of the supernatant from step 4.6.
2. Incubate for 6 to 15 hr (O/N) in a hybridization oven set to 65 °C.
3. Purify DNA using a commercial PCR purification kit. If necessary, use 3 M of sodium acetate (pH 5.2) to adjust pH as recommended by the manufacturer. Elute the DNA twice with 11 μl of elution buffer (10 mM Tris-HCl pH 8.5).
4. Add 0.4 µl of RNase A (20 μg/μl) and 5 µl of 5x DNA loading buffer before running the entire sample alongside a 100 bp and a 1 kb DNA ladder on a 1.4% agarose gel by electrophoresis. For optimal results, stain gel with a safe nucleic acid staining solution after electrophoresis.

6. Chromatin Immunoprecipitation

NOTE: In this section, use low-retention 1.5 ml microcentrifuge tubes and at least 1 ml of indicated buffer per tube to wash magnetic beads for 5 min at 4 °C. Before removing the buffer from the beads, leave the tubes in the magnetic rack for 20 to 30 sec each time or until the solution is clear.

1. Transfer 10 to 30 µl of the supernatant (sheared chromatin) from step 4.6 to a new tube to be used later as input sample, which corresponds to approximately 1% of total chromatin used for ChIP. Store at 4 °C until ChIP samples are ready for reversing cross-links.
2. Transfer the remaining chromatin to a new tube. For ChIP-qPCR experiments requiring an antibody control, distribute equal volumes of chromatin to two tubes.
3. Add the ChIP-grade antibody (or the corresponding antibody control) to chromatin. As a rough guide, use about 1 µg of antibody per one million cells expressing the epitope of interest.
   1. To more accurately estimate the amount of antibody required per ChIP experiment, run the same ChIP with various amounts of antibody (e.g., 0.25 µg, 1 µg and 2.5 µg) and compare the yield at negative and positive control loci by ChIP-qPCR (see section 10). As an antibody control, use normal serum of the same isotype and host animal species as the antibody.
4. Incubate on a rotator (10 rpm) O/N at 4 °C.
5. Wash an adequate amount of antibody-compatible magnetic beads once with E3 for 5 min at 4 °C. Check the manufacturer’s specification for the antibody binding capacity of the beads (usually 5 to 20 µl of beads bind 1 µg of IgG antibody).
6. Add washed beads to the antibody pre-incubated chromatin. Further incubate on a rotator (10 rpm) for 4 hr.
7. Wash beads four times (ChIP-qPCR) or ten times (ChIP-Seq) with pre-chilled RIPA buffer, and then once with pre-chilled TEN buffer.
8. Only carry out this step if performing a ChIP-Seq experiment.
   1. Resuspend washed beads in 50 µl of TEN buffer per tube. Pool all beads from a single ChIP experiment by transferring them to one new tube. Use the magnetic rack and refrigerated (4 °C) centrifugation at 1,000 x g to collect beads at the bottom of the tube. Discard as much liquid as possible without disrupting the pellet of beads.
9. Strip ChIP material off the beads by resuspending the beads in 50 to 100 µl of SDS elution buffer and vortexing them continuously with a thermomixer (1,000 rpm) for 15 min at 65 °C. After that centrifuge at full speed (>15,000 x g) for 30 sec. Transfer the supernatant (ChIP eluate) to a new tube.
10. Repeat the last step and combine the ChIP eluates.

7. Chromatin Reverse Cross-linking and DNA Purification

1. Add enough SDS elution buffer to the input sample (step 6.1) to reach the volume of the ChIP sample, which is 100 to 200 µl (step 6.10). Supplement both ChIP and input samples with 1/20 volume of 5 M NaCl. Incubate the samples for 6 to 15 hr (O/N) at 65 °C in a hybridization oven.
2. Add 1 volume of TE buffer and RNase A at 200 µg/ml. Incubate for 1 hr at 37 °C.
3. Add proteinase K at 200 µg/ml. Incubate for 2 to 4 hr at 55 °C.
4. Purify DNA by phenol:chloroform:isoamyl alcohol extraction followed by ethanol precipitation as previously outlined⁹. For ChIP-Seq, add 32 µl of elution buffer (10 mM Tris-HCl, pH 8.5) to dissolve the DNA pellet. Leave samples on ice for 30 min to ensure that the DNA is completely dissolved.
   NOTE: Commercial PCR purification kits have lower DNA recovery but are more convenient, and can be used for ChIP-qPCR samples.
5. For ChIP-Seq, determine the concentration of 1 µl of ChIP and input DNA using fluorometry-based methods. Follow the manufacturer’s instructions and make sure that concentration of DNA falls within the reliable detection range of the fluorometer.

8. ChIP-Seq Library Construction and Validation

NOTE: Current methods for DNA library preparation allow construction of high-complexity libraries for NGS from 1 to 2 ng. At the expense of some complexity, libraries can be made from as little as 50 pg of DNA (see Table of Specific Materials/Equipment). Use the same amount of DNA for both ChIP and input library. Briefly, to make indexed (paired-end) ChIP-Seq libraries, ChIP and input DNA need to be end-repaired, ligated to special adaptors (see Table of Specific Materials/Equipment), size-selected and PCR amplified.

1. Follow the manufacturer’s guidelines to make ChIP-Seq libraries. See discussion for further recommendations.
2. Elute each library in 12 µl of elution buffer and determine the concentration of 1 µl of each ChIP and input library using a fluorometer. Expect concentrations of 5 to 25 ng/µl. Consider reducing the number of PCR cycles (fewer than 18 cycles) if concentrations are higher than 25 ng/µl.
   NOTE: Accurate quantification is key to achieve optimal NGS results. Libraries with concentrations as low as 1 ng/µl after 18 PCR cycles can be sequenced, but frequently are of lower complexity.
3. Use 1 µl of library to determine the fragment size distribution and to check for any adaptor dimer contamination (band around 120 bp) by chip-based capillary electrophoresis. Repeat the solid phase reversible immobilization purification with a beads-to-sample ratio of 1:1 (instead of 1.6:1) if the library contains adaptor dimers.
4. Perform qPCR on validated positive and negative control loci (see section 10) to check whether similar DNA enrichment trends are observed before and after library preparation. Submit quality control approved libraries for sequencing.

9. Post-sequencing Analysis and Data Visualization

NOTE: Nowadays, NGS is often carried out by in-house or commercial sequencing facilities (see discussion for some NGS guidelines). The standard output are single or multiple gzip-compressed FASTQ files (*.fastq.gz) storing millions of sequencing reads. Normally, multiplexed reads are already separated according to their index and each read contains a sequence identifier and a quality control score (Phred+33 for Illumina 1.8+) for each base call. This approach here is only one out of many ways how to analyze NGS data. The reader is encouraged to check whether any of the following command lines require changes as this field is rapidly advancing and updates are occurring regularly.

1. Concatenate gzip-compressed FASTQ files and check the quality of the sequencing data using the FastQC script. Execute this and most of the following commands for both ChIP and input sequencing data (examples shown for ChIP) from the terminal:
   > cat /path/to/*.fastq.gz > ChIP.fastq.gz
   > fastqc ChIP.fastq.gz
   NOTE: Raw data from the successful sequencing of a high-complexity ChIP-Seq library should pass most tests. Failures originate mainly from poor sequencing runs and experimental artefacts such as biased PCR amplification or adaptor contamination. A certain degree of duplication (redundancy) is expected as redundant reads can represent bona fide DNA enrichment²¹. However, one can later restrict read tags – the 5’ end or reads – to one per base pair to eliminate any redundant reads without affecting the detection sensitivity of peaks (step 9.4)²¹.
2. Pre-process sequencing data to remove adaptor contamination (homerTools trim -3 <adaptor sequence>) allowing one mismatch (-mis 1). Use the first 20 bases of the (indexed) adaptor (5’ to 3’) proximal to the DNA fragment of interest upon ligation (shown for adaptor listed in the Table of Specific Materials/Equipment).
   > gzip -cd ChIP.fastq.gz | fastq_illumina_filter -vN > ChIP.fastq
   > homerTools trim -3 GATCGGAAGAGCACACGTCT -mis 1 -min 36 ChIP.fastq
   NOTE: The removal of filtered reads (-N) is only required by default in FASTQ files generated by Illumina 1.8. Omit the fastq_illumina_filter command (i.e., ‘| fastq_illumina_filter –vN’) if an older version than 1.8 generated the sequence identifier.
3. Align pre-processed reads to the reference genome (xenTro7) using Bowtie. Only keep uniquely mapped reads (-m 1) using default settings, i.e., maximal two mismatches in the first 28 bases and a total Phred+33 quality score of all mismatches per read of maximal 70. Report alignment in SAM format (-S). Increase the number of megabytes per thread (–chunkmbs) if the chunk memory is exhausted:
   > bowtie -m 1 -S -p [# threads] –chunkmbs [e.g. 200] xenTro7 ChIP.fastq.trimmed > ChIP.sam
   NOTE: Bowtie expects Phred+33 quality scores by default. Include the option —phred64-quals if the FASTQ file was generated with Phred+64 quality scores by Illumina older than 1.8.
4. Use two HOMER commands to transform the alignment (SAM) file into a bigWig file (.bw):
   > makeTagDirectory ChIP/ -single -tbp 1 ChIP.sam
   > makeUCSCfile ChIP/ -bigWig /path/to/ genome.fa.fai -fsize 1e20 -norm 1e7 -o ChIP.bw
   NOTE: The transformation requires the scaffold index (genome.fa.fai) of the reference genome (step 1.8). Here the profile is limited to one tag per base pair (-tbp 1) and normalized to 10 million reads (-norm 1e7). bigWig is one of the preferred format to dynamically visualize chromatin profiles with a genome browser such as IGV (step 9.12).
5. Determine the distribution of tags (-d ChIP/) at genomic landmarks (e.g., +/- 10 kb with 25 bp bins, -size 20000 -hist 25) such as the transcription start (tss, example shown here) and termination (tts) sites. Run the HOMER perl script annotatePeaks.pl with Xenopus annotations xenTro7 (step 1.7):
   > annotatePeaks.pl tss xenTro7 -size 20000 -hist 25 -d ChIP/ > ChIP_tagDensity.tss
6. Find significant peaks of DNA enrichment between ChIP (-t ChIP.sam) and Input (-c Input.sam) in the X. tropicalis genome using MACS2 with a 1% FDR cutoff (-q 0.01) and DNA fragments (after sonication) of 200 bp (–bw=200) for model building. Add the flag –broad to this command line if expecting a broad distribution of the chromatin feature of interest such as histone marks or RNA polymerase.
   > macs2 callpeak -t ChIP.sam -c Input.sam -f SAM -n ChIP -g 1.4376e9 -q 0.01 –bw=200
   NOTE: The effective size of the X. tropicalis genome assembly v7.1 is about 1.4376 billion bp (-g 1.4376e9). MACS2 generates a BED file (ChIP_peaks.bed) enlisting peaks with their genomic locations.
7. Compare several chromatin profiles in form of a clustered heatmap:
   1. Create a tag distribution matrix from tag density directories of interest (-d ChIP/ other_ChIP/) at MACS2 peaks (e.g., +/- 1 kb with 25 bp bins, -size 2000 -hist 25 -ghist):
      > annotatePeaks.pl ChIP_peaks.bed xenTro7 -size 2000 -hist 25 -ghist -d ChIP/ other_ChIP/ > ChIP.matrix
   2. Use the graphical user interface of Cluster3 to upload ChIP.matrix file and hierarchically cluster these tag densities based on the minimal Euclidean distance to the closest centroid. Open the generated CTD file in Java TreeView to visualize the clustering.
8. Find novel and previously known binding motifs, which are enriched at peak summits +/- 100 bp (-size 200). Use annotatePeaks.pl to map motif occurrences and to plot motif densities:
   > findMotifsGenome.pl ChIP_peaks.bed xenTro7 ChIP_motifs/ -size 200 -p [# threads]
   > annotatePeaks.pl ChIP_peaks.bed xenTro7 -m motif1.motif > ChIP_peaks.motif1
   > annotatePeaks.pl ChIP_peaks.bed xenTro7 -m motif1.motif -size 800 -hist 25 > motif1.density
   NOTE: The findMotifsGenome.pl script infers the enrichment from the comparison to randomly selected gene-centric background sequences. The most enriched novel motif is saved under motif1.motif in the format of a position weight matrix. The reader is encouraged to substantiate these results with other de novo motif discovery methods such as cisFinder²² and MEME²³.
9. Annotate peaks by calculating their distance to the nearest gene and by determining their normalized read count within 400 bp windows (-size 400):
   > annotatePeaks.pl ChIP_peaks.bed xenTro7 -size 400 -d ChIP/ Input/ > ChIP_peaks.genes
10. Summarize the output using the following awk command to list the number (N), location and normalized read count of individual (R) and all (LR) peaks per nearest (target) gene.
    > awk 'BEGIN{ FS='t' } $7 >= -5000 && $7 <= 1000
    { N[$8]+=1; R[$8]+=$9; LR[$8]=LR[$8]','$7'('$9')' } END{ for(i in N)
    { print i 't' N[i] 't' R[i]' t' substr(LR[i],2)}}' ChIP_peaks.genes > ChIP_peaks.summary
    NOTE: The number after $ refers to the column number, which may need modifying to fit the ChIP_peaks.genes file created in the previous step. This script exemplar filters out peaks beyond 5 kb upstream and 1 kb downstream of the TSS. $7, $8 and $9 refer to the distance to the TSS, the gene identifier and the normalized read count per peak, respectively.
11. Perform the analysis of enriched GO terms among target genes as follows:
    1. Start the graphical user interface of Blast2GO from the command line via Java Web Start (javaws)¹⁹.
       > javaws http://blast2go.com/webstart/blast2go1000.jnlp
    2. Follow the developers’ instructions to upload the annotation file for Xenopus genes (xenTro7.annot) as generated in 1.9.4 and a flat file of identified target genes. Make sure that the same gene identifiers are used in both files.
12. Visualize chromatin profiles by adding bigWig (ChIP.bw, Input.bw) and BED files (ChIP_peaks.bed) into IGV as tracks. Complement data with RNA-Seq tracks if available for the same stage of development. Save results as a session.
13. Use programming platforms R (www.r-project.org) or MATLAB to further manipulate and visualize data as generated above. Alternatively, plot small datasets with Excel.

10. ChIP-qPCR for Testing ChIP and Confirming ChIP-Seq

1. Use the on-line platform Primer3 to design primers surrounding approximately 100 bp DNA at 60 °C (T_m) for both positive (peak-specific) and negative control loci. Confirm primer specificity using the in silico PCR search implemented into the UCSC Genome Browser.
2. Create an 8-point standard curve of three-fold dilutions starting from approximately 1% input or use the 2^−ΔΔC(T) method^8,24 for the quantification of DNA enrichment.
3. Execute real-time PCR in technical triplicates for all samples, i.e., ChIP, control and, if need be, standard curve samples.
4. Plot DNA enrichment as the percentage of input DNA or as a ratio of ChIP versus control sample at both positive and negative control loci.