تقييد أنزيم الاستنساخ القائم على أسلوب لتقييم<em> في المختبر</em> القدرة تكرار HIV-1 النوع الفرعي C-الكمامة MJ4 همي الفيروسات
Summary
HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.
Abstract
The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.
Introduction
تحديد كل من المضيف وخصائص الفيروسية التي تؤثر HIV-1 المرضية وتطور المرض هو الهدف الأسمى لتصميم لقاح عقلانية. الاستجابة المناعية الخلوية عنصرا أساسيا من الاستجابة المناعية للعدوى البشرية HIV-1. السامة للخلايا T الليمفاوية (CTL) ضرورية لمراقبة الأولية من افيروس الحاد، وتسمح المضيف لتأسيس حالة مستقرة (مجموعة نقطة) الحمل الفيروسي 1،2. نضوب التجريبية من هذه الخلايا المستجيب النتائج في فقدان السيطرة الفيروسية 3،4. على الرغم من هذا، والهروب تنشأ الطفرات داخل الجينوم الفيروسي أن تخريب الاعتراف CTL من الخلايا المصابة فيروسي 5-9.
وقد ارتبطت أليل HLA معينة مع انخفاض الأحمال الفيروسية وتباطؤ تطور المرض بما في ذلك B * 57، B * 27 و 81 * B 10-15. ويمكن أن يعزى جزء من فائدة وقائية من الدرجة HLA I الأليلات إلى حقيقة أنها مقيدة وظيفيا استهداف مناطق من الجينوم مثل الكمامةوحدد للطفرات الهروب التي تقلل من قدرة الفيروس على تكرار في المختبر 16-21. على الرغم من الهروب من نظام المناعة الخلوية هو مفيد للفيروس في سياق الطبقة اختيار أليل HLA I، وتأثير هذه الطفرات قد تكون له عواقب التفاضلية للمضيف على انتقال لHLA-متطابقة الفردية 22،23. ولذلك، فهم آثار الطفرات الهروب المرتبط HLA تنتقل القدرة على تكاثر الفيروس سيكون من المهم تعزيز فهمنا لأوائل HIV-1 المرضية.
بينما تم إحراز تقدم كبير في تحديد وتوصيف العيوب اللياقة البدنية من الطفرات الهروب الفردية المرتبطة الدرجة HLA محددة I الأليلات 24-29، تحدث بشكل طبيعي HIV-1 العزلات وآثار أقدام فريدة ومعقدة من الأشكال HLA المصاحب، من المحتمل الناشئة عن HLA ضغط المناعة بوساطة من مختلف الخلفيات مستمنع 30. في أبتحليل revious، Goepfert وآخرون. أظهرت أن تراكم HLA المصاحب الطفرات في تسلسل الكمامة تنتقل المستمدة من 88 الزامبيين المصابة تماما كان مرتبطا مع انخفاض في مجموعة الحمل الفيروسي نقطة 31. اقترح هذا أن نقل من الطفرات الضارة الهروب، وتحديدا في الكمامة، إلى المستلمين HLA-متطابقة يوفر فائدة سريرية، وربما يعود لتكاثر الفيروس الموهن. المضي قدما، لا بد من دراسة كيفية مجموعات من الأشكال الكمامة داخل مجمع العزلات التي تحدث بشكل طبيعي تعمل في تناسق لتحديد خصائص الفيروس ينتقل مثل القدرة تكرارها، وكيفية تكرارها في وقت مبكر قد يؤثر بدوره HIV-1 المعلمات السريرية والمراحل المتأخرة المرضية.
بروكمان وآخرون أظهرت لأول مرة وجود علاقة بين القدرة تكرار متواليات هفوة الموالية معزولة خلال مرحلة الإصابة المزمنة والحمل الفيروسي C في كل من فرعي والتهابات B32-35. المنهج التجريبي المقدم في هذه الدراسات، على الرغم المناسب لاختبار قدرة تكرارها في المختبر من متواليات المستمدة من الأشخاص المصابين بشكل مزمن، لديها العديد من المحاذير والقيود الفنية التي تجعل من دراسة HIV-1 قدرة تنسخي في النوع الفرعي C المصابين تماما صعوبة. ويعتمد هذا الأسلوب على إعادة التركيب من القائمة على السكان تسلسل PCR تضخيم في النوع الفرعي B NL4-3 طليعة الفيروس، والتي كانت مستمدة جزئيا من LAV، تكييف مختبر الفيروسات الأسهم 36. تم انجازه الجيل الفيروس عن طريق التعاون ترنسفكأيشن خط T-خلية مقرها CEM-37 مع amplicons PCR وهضمها delta–هفوة الموالية NL4-3 DNA. يتطلب هذا الأسلوب ثمرة من الفيروسات على مدى فترة من أسابيع إلى أشهر، وربما انحراف طبيعة الأسهم فيروس تعافى فيما يتعلق quasispecies الفيروسية في الجسم الحي، وبالتالي تغيير قياس قدرة تكرارها في المختبر. طريقة هذا طهو أكثر مناسبة لدراسة الأفراد المصابين المزمنين، حيث يختار بشكل فعال للفيروس وفقا لأعلى قدرة تنسخي، وحيث استنساخ العديد من المتغيرات الفيروسية مختلفة من عدد كبير من الأشخاص المصابين بشكل مزمن هو العمل المكثف تماما، وبالتالي لا جدوى. ومع ذلك، داخل الفرد المصاب تماما، وهناك عموما 1-2 متغيرات الحاضر، وبالتالي القضاء على خطر انحراف طبيعة الفيروس الأسهم المستردة، في المختبر من خلال الضغوط الاختيار، ويسمح لإجراء تقييم أكثر دقة للفي المختبر قدرة النسخ المتماثل. ثانيا، هذا الأسلوب يتطلب إعادة توحيد فرعي C-هفوة الموالية تسلسل إلى النمط الفرعي B العمود الفقري المشتقة، ويمكن إدخال العمود الفقري التحيزات عدم التوافق في التحليل. بسبب هذه القيود، يجب تحليل أعداد كبيرة من متواليات من أجل التغلب على أي التحيزات المحتملة قدم.
نحن هنا وصف لAPPRO التجريبي بديلمنظمة العمل ضد الجوع المناسب لدراسة تسلسل المستمدة من النوع الفرعي C الأفراد المصابين تماما. نحن نستخدم استراتيجية استنساخ انزيم التقييد استنادا إلى إدخال الجين هفوة المستمدة من النقاط الزمنية العدوى الحادة للHIV-1 النوع الفرعي C المصابين في العمود الفقري proviral النوع الفرعي C، MJ4. استخدام MJ4 بمثابة العمود الفقري شيوعا التي لاستنساخ الجينات أسكت أمر بالغ الأهمية لتحليل النوع الفرعي C تسلسل مشتقة. مشتق MJ4 من عزل الأساسي 38، وبالتالي سيكون أقل احتمالا لتقديم التحيز بسبب عدم التوافق بين فرعي العمود الفقري والجينات هفوة. وبالإضافة إلى ذلك، فإن النهج القائمة على استخدام انزيم تقييد الاستنساخ يسمح للproviral يبني أن transfected مباشرة إلى خلايا 293T، وانتعاش الأسهم فيروس النسيلي مطابقة للتسلسل هفوة المستنسخة.
طريقة الواردة أدناه هي طريقة إنتاجية عالية لتقييم قدرة تكرار النوع الفرعي C المستمدة الكمامة-MJ4الفيروسات خيالية. ترنسفكأيشن في الخلايا 293T واضح ومباشر والتعافي من الفيروس يأخذ ثلاثة أيام فقط. ويعاير في المختبر قدرة النسخ المتماثل على نفس أساس خط T-خلية CEM-CCR5 التي أنشأتها بروكمان وآخرون 37، ولكن باستخدام بروتوكول التعديلات الهامة اللازمة لتكرار النجاح من النوع الفرعي C MJ4 الفيروسات خيالية. استخدام خط T-خلية المناسب بدلا من PBMCs يسمح لأعداد كبيرة من النوع الفرعي C-MJ4 خيالية الفيروسات لفحصها مع فحص عالية التكاثر. أخيرا، وذلك باستخدام رديولبلد الناسخ العكسي لفحص الكمي للفيروس في طاف هو أكثر فعالية من استخدام P24 المتاحة تجاريا مجموعات ELISA التكلفة. كما انه يعطي مجموعة أعلى ديناميكية، وهذا أمر مهم للكشف عن الفيروسات على حد سواء سيئة للغاية وتكرار في نفس الفحص وللكشف عن الفروق الدقيقة في النسخ المتماثل بين العزلات.
في الختام، فإن الطريقة المعروضة هنا قد سمح لدراسة متعمقة لقدرات تكرار متواليات هفوة المستمدة من HIV-1 النوع الفرعي C إصابة حادة الأفراد من زامبيا، وكما هو مكتوب، ويمكن أيضا أن توسعت لدراسة النوع الفرعي الآخر C إصابة السكان. ولوحظ وجود درجة عالية من التباين في القدرات النسخ المتماثل بين العزلات الكمامة مختلفة. بالإضافة إلى ذلك، كنا قادرين على إظهار ارتباط إحصائية بين قدرة تكرار الكمامة تنتقل ووضع نقطة الحمل الفيروسي وكذلك مع CD4 + انخفاض على مدى فترة ثلاث سنوات 39. هذه النتائج تبرز أهمية دراسة الخصائص الفيروسية كيف تنتقل، مثل القدرة التكرار، تتفاعل مع الجهاز المناعي المضيفة للتأثير المرضية خلال العدوى في وقت مبكر، وسوف تكون متكاملة لتطوير لقاح التدخلات الفعالة وكذلك العلاج.
Protocol
Representative Results
Discussion
بسبب طول وطبيعة التقنية لهذا البروتوكول، وهناك العديد من الخطوات التي تعتبر بالغة الأهمية لكل من البناء الناجح خيالية البلازميدات الكمامة-MJ4 وكذلك لتقدير حجم القدرة تكاثر الفيروس. على الرغم من أن استراتيجية استنساخ انزيم التقييد استنادا لإدخال الجينات هفوة ال…
Declarações
The authors have nothing to disclose.
Acknowledgements
The investigators thank all the volunteers in Zambia who participated in this study and all the staff at the Zambia Emory HIV Research Project in Lusaka who made this study possible. The investigators would like to thank Jon Allen, Smita Chavan, and Mackenzie Hurlston for technical assistance and sample management. We would also like to thank Dr. Mark Brockman for his discussions and generous donation of the GXR25 cells.
This study was funded by R01 AI64060 and R37 AI51231 (EH) and the International AIDS Vaccine Initiative. This work was made possible in part by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the study authors and do not necessarily reflect the views of USAID or the United States Government. This work also was supported, in part, by the Virology Core at the Emory Center for AIDS Research (Grant P30 AI050409). DC and JP were supported in part by Action Cycling Fellowships. This work was supported in part by the Yerkes National Primate Research Center base grant (2P51RR000165-51). This project was also funded in part by the National Center for Research Resources P51RR165 and is currently supported by the Office of Research Infrastructure Programs/OD P51OD11132.
Materials
| Name of the Reagent | Company | Catalogue number | Comments |
| PCR reagents | |||
| GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| VifOR: 5' TTCTACGGAGACTCCATGACCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
| BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' |
IDT DNA | Custom Oligo | 25nmol, standard desalt |
| MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| GagF2: 5' GGGACATCAAGCAGCCAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| GagR6: 5' CTGTATCATCTGCTCCTG 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' | IDT DNA | Custom Oligo | 25nmol, standard desalt |
| CoolRack PCR 96 XT | Biocision | BCS-529 | |
| CoolRack M15 | Biocision | BCS-125 | |
| Nuclease free water | Fisher | SH30538FS | Manufactured by Hyclone |
| QIAamp Viral RNA Mini Kit | Qiagen | 52906 | |
| Simport PCR 8 Strip Tubes, Blue (Flat Cap) | Daigger | EF3647BX | |
| SuperScript III one-step RT-PCR system | Life Technologies/Invitrogen | 12574035 | |
| Phusion Hot-start II DNA polymerase | Fisher | F-549L | |
| PCR Nucleotide Mix | Roche | 4638956001 | |
| Agarose, high gel strength | Fisher | 50-213-128 | |
| TAE 10X | Life Technologies/Invitrogen | AM9869 | |
| Promega 1kb DNA ladder | Fisher | PRG5711 | Manufactured by Promega |
| Sybr Safe DNA Gel Stain, 10000x | Life Technologies/Invitrogen | S33102 | |
| Wizard SV Gel and PCR Clean-Up System | Promega | A9282 | |
| Razor blades, single-edged | Fisher | 12-640 | Manufactured by Surgical Design |
| Thermocycler, PTC-200 | MJ Research | ||
| Microbiology & Cloning reagents | |||
| LB Agar, Miller | Fisher | BP1425-2 | |
| LB Broth, Lennox | Fisher | BP1427-2 | |
| Sterile 100mm x 15mm polystyrene petri dishes | Fisher | 08-757-12 | |
| Ampicillin sodium salt | Sigma-Aldrich | A9518-5G | |
| Falcon 14ml Polypropylene round-bottom tubes | BD Biosciences | 352059 | |
| NgoMIV restriction endonuclease | New England BioLabs | R0564L | |
| BclI restriction endonuclease | New England BioLabs | R0160L | |
| HpaI restriction endonuclease | New England BioLabs | R0105L | |
| T4 DNA Ligase, 5U/μL | Roche | 10799009001 | |
| JM109 competent cells, >10^8 cfu/μg | Promega | L2001 | |
| PureYield plasmid miniprep system | Promega | A1222 | |
| Safe Imager 2.0 Blue Light Transilluminator | Invitrogen | G6600 | |
| Microfuge 18 centrifuge | Beckman Coulter | 367160 | |
| Cell culture reagents | |||
| Amphyl cleaner/disinfectant | Fisher | 22-030-394 | |
| Fugene HD, 1 mL | VWR | PAE2311 | Manufactured by Promega |
| Hexadimethrine bromide (Polybrene) | Sigma-Aldrich | H9268-5G | |
| Costar Plates, 6-well, flat | Fisher | 07-200-83 | Manufactured by Corning Life |
| Costar Plates, 24-well, flat | Fisher | 07-200-84 | Manufactured by Corning Life |
| Costar Plates, 96-well, round | Fisher | 07-200-95 | Manufactured by Corning Life |
| Flasks, Corning filter top/canted neck, 75 cm^2 | Fisher | 10-126-37 | |
| Flasks, Corning filter top/canted neck, 150 cm^2 | Fisher | 10-126-34 | Manufactured by Corning Life |
| Conical Tubes, 50ml, blue cap | Fisher | 14-432-22 | Manufactured by BD Biosciences |
| Conical Tubes, 15ml, blue cap | Fisher | 14-959-70C | Manufactured by BD Biosciences |
| Trypsin-EDTA | Fisher | MT25052CI | Manufactured by Mediatech |
| RPMI, 500 ml | Life Technologies/Invitrogen | 11875-119 | |
| DMEM, 500 ml | Life Technologies/Invitrogen | 11965-118 | |
| Penicillin/Streptomycin/Glutamine, 100X | Life Technologies/Invitrogen | 10378-016 | |
| PBS with magnesium and calcium, 500ml | Life Technologies/Invitrogen | 14040-133 | |
| PBS without magnesium and calcium | Life Technologies/Invitrogen | 20012-050 | |
| Sarstedt tubes, assorted colors | Sarstedt | 72.694.996 | |
| Reservoir Trays for Multichannel, 55ml | Fisher | 13-681-501 | |
| DEAE-Dextran | Fisher | NC9691007 | |
| Corning 96 well clear V bottom tissue culture treated microplate | Fisher | 07-200-96 | Manufactured by Corning Life |
| HEPES, 1M Buffer Solution | Life Technologies/Invitrogen | 15630-080 | |
| FBS, Defined, 500 ml | Fisher | SH30070 03 | |
| X-gal | VWR | PAV3941 | Manufactured by Promega |
| Glutaraldehyde, Grade II, 25% in H2O | Sigma-Aldrich | G6257-100ML | |
| 1M Magnesium chloride solution | Sigma-Aldrich | M1028-100ML | |
| Formaldehyde solution, for molecular biology, 36.5% | Sigma-Aldrich | F8775-500ML | |
| Potassium hexacyanoferrate(II) trihydrate | Sigma-Aldrich | P9387-100G | |
| Potassium hexacyanoferrate(III) | Sigma-Aldrich | P8131-100G | |
| Allegra X15-R centrifuge | Beckman Coulter | 392932 | |
| TC10 automated cell counter | Bio-Rad | 1450001 | |
| VistaVision inverted microscope | VWR | ||
| Reverse-Transcriptase Quantification Assay reagents | |||
| dTTP, [α-33P]- 3000Ci/mmol, 10mCi/ml, 1 mCi | Perkin-Elmer | NEG605H001MC | |
| 1M Tris-Cl, pH 8.0 | Life Technologies/Invitrogen | 15568025 | Must be adjusted to pH 7.8 with KOH |
| 2M potassium chloride (KCl) | Life Technologies/Invitrogen | AM9640G | Adjust to 1M solution |
| 0.5M EDTA | Life Technologies/Invitrogen | 15575-020 | |
| Nonidet P40 | Roche | 11333941103 | |
| Polyadenylic acid (Poly rA) potassium salt | Midland Reagent Co. | P-3001 | |
| Oligo d(T) primer | Life Technologies/Invitrogen | 18418-012 | |
| Dithiothreitol (DTT) | Sigma-Aldrich | 43815-1G | |
| SR, Super Resolution Phosphor Screen, Small | Perkin-Elmer | 7001485 | |
| Corning Costar Thermowell 96 well plate model (M) Polycarbonate | Fisher | 07-200-245 | Manufactured by Corning Life |
| Corning 96 Well Microplate Aluminum Sealing Tape, Nonsterile | Fisher | 07-200-684 | Manufactured by Corning Life |
| DE-81 anion exchange paper | Whatman | 3658-915 | |
| Trisodium citrate dihydrate | Sigma-Aldrich | S1804-1KG | |
| Sodium Chloride | Fisher | S671-3 | |
| Autoradiography cassette | Fisher | FB-CA-810 | |
| Cyclone storage phoshpor screen | Packard |
Referências
- Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
- Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
- Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
- Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
- Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
- Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
- Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
- Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
- Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
- Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
- Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
- Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
- Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
- Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
- Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
- Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
- Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
- Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
- Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
- Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
- Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
- Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
- Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
- Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
- Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
- Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
- Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
- Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
- Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
- Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
- Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
- Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
- Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
- Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
- Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
- Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
- Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
- Ndung’u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
- Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
- Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan … [et al.]. 12 (Unit 12 15), .
- Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
- Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
- Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genética. 154, 533-542 (2000).
- Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
- Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
- Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
- Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
- Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
