Source: Naeimi Kararoudi, M., et al. Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins. J. Vis. Exp. (2018).
This video demonstrates a technique for Cas9 ribonucleoprotein-mediated genetic modification of primary natural killer (NK) cells. A Cas9 ribonucleoprotein, consisting of a Cas9 endonuclease bound to a guide RNA (gRNA) formed by base pairing a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA), is introduced into primary natural killer cells via electroporation. The ribonucleoprotein targets and cleaves the host DNA at the target site, leading to gene knockout via modification of the target gene through cellular repair machinery.
All procedures involving sample collection have been performed in accordance with the institute's IRB guidelines.
1. Human NK Cell Purification and Expansion
2. gRNA Design and Selection
3. Design Deletion Screening Primers
4. Transduction of Human Primary and Expanded NK Cells
Note: Transduction of Cas9/RNPs elements into NK is done by electroporation using 4D system as follows.
Table 1. Three designed gRNAs to target exon 4 of TGFBR2 ectodomain as synthetic crRNA.
gRNA NO. | gRNA sequence | Ordered as synthetic crRNA |
gRNA1 | 5 CCCCTACCATGACTTTATTC 3 | /AltR1/rArGrUrCrArUrGrGrUrArGrGrGrGrArGrCrUrUrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/ |
gRNA2 | 5 ATTGCACTCATCAGAGCTAC 3 | /AltR1/rArUrUrGrCrArCrUrCrArUrCrArGrArGrCrUrArCrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AltR2/ |
gRNA3 | 5 AGTCATGGTAGGGGAGCTTG 3 | /AltR1/rArG rUrCrA rUrGrG rUrArGrGrGrG rArGrC rUrUrG rGrUrUrUrUrA rGrArG rCrUrA rUrGrCrU/AltR2/ |
Table 2. Primers used to amplify the TGFBR2 ectodomain gene
TGFBR 2 ectodomain Primers FWD | 5 GTC TGC TCC AGG TGA TGT TTA T3 |
TGFBR2 ectodomain Primer REV | 5 GGG CCT GAG AAT CTG CAT TTA 3 |
Table 3. Form the crRNA:tracrRNA/complex using 200 µM RNAs
Component | Amount (uL) |
200 µM crRNA | 2.2 |
200 µM Tracer RNA | 2.2 |
IDTE Buffer | 5.6 |
Final product | 10 |
Table 4. For single crRNA:tracrRNA duplex reaction, dilute Cas9 endonuclease to 36 µM.
Component | Amount (µL) |
PBS | 1 |
crRNA:tracrRNA duplex (from step 4.2) | 2 (200 pmol) |
Alt-R Cas9 endonuclease (61 µM stock) | 2 |
Total volume | 5 ul |
Table 5. For combination transduction of crRNA:tracrRNA duplexes dilute Cas9 endonuclease to 36 µM.
Component | Amount (µL) |
PBS | 1 |
crRNA:tracrRNA duplex (ex. gRNA1) | 1 (100 pmol) |
crRNA:tracrRNA duplex (ex. gRNA2) | 1 (100 pmol) |
Alt-R Cas9 endonuclease | 2 |
Total volume | 5 µL |
The authors have nothing to disclose.
RosetteSep™ Human NK Cell Enrichment Cocktail | STEMCELL Technologies | 15065 | The RosetteSep™ Human NK Cell Enrichment Cocktail is designed to isolate NK cells from whole blood by negative selection. |
Ficoll-Paque® PLUS | GE Healthcare – Life Sciences | 17-1440-02 | |
Alt-R® CRISPR-Cas9 tracrRNA | Integrated DNA Technologies | 1072532 | TracrRNA that contains proprietary chemical modifications conferring increased nuclease resistance. Hybridizes to crRNA to activate the Cas9 enzyme |
Alt-R® CRISPR-Cas9 crRNA | Integrated DNA Technologies | Synthetically produced as Alt-R® CRISPR-Cas9 crRNA, based on the sequence of designed gRNA targeting the gene of intrest | |
Alt-R® Genome Editing Detection Kit | Integrated DNA Technologies | 1075931 | Each kit contains T7EI endonuclease, T7EI reaction buffer, and T7EI assay controls. |
Platinum® Taq DNA Polymerase High Fidelity | Invitrogen | 11304-011 | |
4D-Nucleofector™ System | Lonza | AAF-1002B | |
Human recombinant IL-2 Protein | Novartis | 65483-0116-07 | |
P3 Primary Cell 4D-Nucleofector™ X Kit | Lonza | V4XP-3032 | Contains pmaxGFP™ Vector, Nucleofector™ Solution, Supplement, 16-well Nucleocuvette™ Strips |
Non-targeting: Custom siRNA, Standard 0.05 2mol ON-TARGETplus | Dharmacon | CTM-360019 | |
Alt-R® S.p. Cas9 Nuclease 3NLS | Integrated DNA Technologies | 1074181 | Cas9 Nuclease |
DNeasy® Blood & Tissue Handbook | Qiagen | 69504 | |
RNeasy Mini Kit | Qiagen | 74104 | |
Calcein AM | ThermoFisher | C3099 | |
TGFβ | Biolegend | 580706 | |
Alt-R® CRISPR-Cas9 Control Kit, Human | Integrated DNA Technologies | 1072554 | Includes tracrRNA, HPRT positive control crRNA, negative control crRNA#1, HPRT Primer Mix, and Nuclease-Free Duplex Buffer. |
IDTE pH 7.5 (1X TE Solution) | Integrated DNA Technologies | 11-01-02-02 | |
Alt-R® Cas9 Electroporation Enhancer | Integrated DNA Technologies | 1075915 | Cas9 Electroporation Enhancer |
.