Improving Small RNA-seq: Less Bias and Better Detection of 2′-O-Methyl RNAs

1. Isolation of small RNAs

1. Extract total RNA using phenol-based reagents or any other method. Verify if the RNA is of good quality.
2. Pre-run a 15% TBE-urea gel (see Table of Materials) for 15 min at 200 V.
3. While the gel is pre-running, mix 5-20 µg of total RNA in a 5-15 µL volume with an equal volume of formamide loading dye (see Table of Materials; 95% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 5 mM EDTA pH 8) in a 200 µL PCR tube. Likewise, mix 10 µL (200 ng) of small-RNA ladder (see Table of Materials) with an equal volume of formamide loading dye. Incubate for 5 min at 65 °C in a thermocycler with heated lid, then place the tubes immediately on ice.
4. Load the ladder and the sample on the same gel with at least one lane between them and run at 200 V until the bromophenol blue (dark blue) has migrated about two-third of the gel length (approximately 40 min).
5. Prepare a system to elute the RNA from gel as follows: puncture the bottom of a nuclease-free 0.5 mL micro centrifuge tube with a 21-gauge needle. Place the punctured 0.5 mL tube in a nuclease-free round-bottom 2 mL micro centrifuge tube.
6. Remove the gel, and incubate at room temperature with 3 μL nucleic acid gel stain (10,000 x concentrate; see Table of Materials) in 30 mL water for 10-15 min.
7. View the gel on a 'Dark Reader' trans illuminator (it is strongly recommended to avoid UV as this might damage the RNA) and cut out the sample RNA between the 17 nt and the 29 nt ladder bands. Transfer the gel piece to the 0.5 mL tube from step 1.5.
8. Centrifuge the 0.5 mL tube in the 2 mL tube in a micro centrifuge at maximum speed for 2 min. Remove the 0.5 mL tube, which should be empty now.
9. Add 300 µL of nuclease-free 0.3 M NaCl to the 2 mL tube containing the crushed gel and rotate for at least 2 h at room temperature or at 4 °C overnight (16 h).
10. Transfer the suspension of crushed gel pieces to a spin column (see Table of Materials) and centrifuge for 2 min at maximum speed in a micro centrifuge.
11. Add 1 µL (20 µg/µL) of glycogen (see Table of Materials) and 950 µL of room temperature 100% ethanol. Incubate for at least 30 min at -80 °C.
12. Centrifuge for 20 min at maximum speed in a micro centrifuge at 4 °C. Remove the supernatant, wash the pellet with 800 µL of cold 80 % ethanol. Centrifuge again for 5 min at 4 °C, and carefully remove all supernatant. Resuspend RNA pellet in 15 µL of nuclease free water. Typically, ~5-20 ng of small RNA should be recovered, depending on the amount of input total RNA (~1 ng of small RNA per 1 µg of input total RNA).
13. Recommended additional step: Check the quantity and quality of the recovered sRNA (e.g., by capillary gel electrophoresis using a small RNA kit; see Table of Materials).

2. Preparation of preadenylated 3' HD adapter

NOTE: Preadenylation of 3' HD adapter was done in a manner similar to the protocol described by Chen et al¹⁸. Note that preadenylated adapter can be ordered directly (/5rApp/ modification), but this is quite expensive.

1. Order 5' phosphorylated, 3' blocked 3' HD adapter oligonucleotide. See Table 1 for sequence and modifications. Note that '3AmMO' is a 3' amino modifier group, most suppliers can produce oligonucleotide with this modification. Dilute in nuclease free water to 100 µM.
2. Set up a 100 µL reaction containing the following reagents: 10 µL of oligo (100 µM), 10 µL of T4 RNA ligase buffer (10x), 10 µL of ATP (10 mM), 40 µL of 50% PEG8000, 5 µL of T4 RNA ligase 1 (50 units), 25 µL of nuclease-free water. Incubate overnight at 20 °C.
3. Perform a classical phenol-chloroform extraction of the preadenylated oligonucleotide followed by ethanol precipitation. Add 100 µL of acid (pH 4.5) phenol:chloroform and vortex. Spin for 5 min at room temperature, maximum speed. Carefully transfer 90 µL of the upper phase to a new tube; add 10 µL of 3 M sodium acetate pH 5.2, 1 µL of ultra-pure glycogen and 250 µL of cold 100% ethanol.
4. Keep at -20 °C for at least 30 min. Centrifuge for 30 min at 4 °C maximum speed. Remove the supernatant, wash the pellet once with 500 µL cold 80% ethanol. As an alternative to phenol-chloroform extraction and ethanol precipitation, a nucleotide removal kit can be used (see Table of Materials). Resuspend in 25 µL water.
5. Measure the concentration of the adapter using a kit for specific detection of single-stranded DNA (see Table of Materials). Dilute to 80 ng/µL (10 µM). 
6. Recommended additional step: Verify the efficacy of preadenylation by migrating 1 µL of 10 µM adapter on a 15% TBE-urea gel (Table of Materials) along with untreated oligonucleotide. The preadenylated adapter should migrate slightly slower than untreated oligonucleotide. If desired, the preadenylated adapter can be gel-purified; proceed as described above (steps 1.2-1.12).

3. Library preparation – Protocol TS5

NOTE: We present here the modified TS protocol 'TS5' that we described previously¹² and that can be performed either with reagents from the kit or with self-provided reagents. It should be noted that we obtained similar or even slightly better results with a different protocol, 'TS7'. However, with TS7 it is more difficult to eliminate adapter dimers. We have therefore preferred to describe TS5 in detail, but TS7 can be followed by simply replacing the adapters. For TS7 use the 'MidRand-Like (MRL)' adapter sequences (Table 1). Note that here the randomized regions are in the middle of the adapters. Primers for reverse transcription and PCR will hybridize to the sequences downstream of the randomized region in the 3' adapter and upstream of the randomized region in the 5' adapter. Sequencing will start from the first randomized nucleotide in the 5' adapter.

1. 3' adapter ligation.
   1. Combine 1 µL of preadenylated 3' HD adapter (10 µM) with 1 µL of purified small RNA (~0.1-1 µM) in a 0.2 mL micro centrifuge tube. Incubate for 2 min at 72 °C in a thermo cycler, then put directly on ice.
   2. Add 4 µL of 50 % PEG 8000 (viscous solution; pipet slowly), 1 µL of RNA ligase buffer (10x), 1 µL of H₂O, 1 µL of T4 RNA ligase2 truncated, and 1 µL of RNase inhibitor. Incubate overnight at 16 °C.
2. Elimination of unligated 3' adapter
   1. Add 10 µL of nuclease-free water and mix well. Add 6 µL of 3 M NaOAc pH 5.2 or 'Adapter Depletion Solution' from the Nf kit (Table of Materials) and mix well. Add 40 µL of magnetic purification beads (Table of Materials) and 60 µL of isopropanol and mix well. Incubate for 5 min at room temperature.
   2. Put the sample in a magnetic rack until the solution appears clear. Remove and discard the supernatant.
   3. Add 180 µL of freshly prepared 80 % ethanol. Incubate for ~30 s, then remove. Take care to use freshly prepared 80% ethanol and do not incubate with 80% ethanol for extended periods.
   4. Briefly spin the tube and remove residual liquid that may have collected at the bottom of the well. Let the beads dry for 2 min, then resuspend in 22 µL of 10 mM Tris pH 8 or resuspension buffer from the Nf kit. Incubate for 2 min, then magnetize the sample until the solution appears clear.
   5. Add 6 µL of 3 M NaOAc pH 5.2 or ‘Adapter Depletion Solution’ from the Nf kit (Table of Materials) to a new tube. Transfer 20 µL of the supernatant from the previous step to this new tube and mix by pipetting. Add 40 µL of magnetic beads and 60 µL of 100% isopropanol and mix well by pipetting. Incubate for 5 min.
   6. Magnetize the sample until the solution appears clear, then remove and discard the supernatant.
   7. Add 180 µL of freshly prepared 80 % ethanol. Incubate for ~30 s, then remove. Take care to use freshly prepared 80% ethanol and do not incubate for with 80% ethanol for extended periods.
   8. Briefly spin the tube and remove residual liquid that may have collected at the bottom of the well. Let the beads dry for 2 min, and resuspend in 10 µL of nuclease-free water. Incubate for 2 min, then magnetize the sample until the solution appears clear.
   9. Transfer 9 µL of supernatant to a new tube. Add 1 µL of T4 RNA ligase buffer (10x) and 1 µL of water. Alternatively, add 2 µL of ligase buffer from the TS kit.
3. Ligation of 5' adapter.
   1. Add 1 µL of 5' HD adapter (10 µM; Table 1) to a 200 µL PCR tube in a thermo cycler with heated lid. Incubate for 2 min at 70 °C, then put the tube directly on ice.
   2. Add 1 µL of 10 mM ATP and 1 µL of T4 RNA ligase 1. Mix well by gently pipetting. Add 3 µL of this mix to the 3' ligated RNA from step 3.2.9 and mix by pipetting. Incubate for 1 h at 28 °C.
4. Reverse transcription (RT)
   1. Transfer 6 µL of 3' and 5' adapter ligated RNA to a new 200 µL PCR tube (keep the remaining ~8 µL at -80 °C for later use if necessary). Add 1 µL of RT primer (10 µM; Table 1) and mix by pipetting. Incubate for 2 min at 70 °C, then put the tube directly on ice.
   2. Add the following reagents for RT: 2 µL of 5x first strand buffer, 0.5 µL of 12.5 mM dNTP mix, 1 µL of 100 mM DTT, 1 µL of RNase inhibitor, and 1 µL of reverse transcriptase (Table of Materials). Incubate for 1 h at 50 °C.
5. PCR amplification
   1. Add the following reagents to the 12.5 µL of RT reaction mixture: 10 µL of PCR polymerase buffer, 2 µL of universal P5 primer (10 µM; Table 1), 2 µL of P7-index primer (10 µM; Table 1), 1 µL of 12.5 mM dNTPs, 0.5 µL of DNA polymerase (Table of Materials), and 22 µL of water. Keep the reaction on ice until use.
   2. Run the following PCR program: 98 °C for 30 s, 11 cycles (98 °C for 10 s, 60 °C for 30 s and 72 °C for 15 s) and 72 °C for 10 min. Keep the reaction at 4 °C when finished.
      NOTE: Concerning the number of PCR cycles: we typically perform 11 cycles, but this should be optimized by the user. Try to perform the smallest possible number of PCR cycles.
6. Gel purification
   1. Run 5, 10 and 20 µL of PCR product on a native 6% TBE gel (see Table of Materials) along with a suitable ladder (see Table of Materials). Run the gel for about 1 h at 145 V (until the bromophenol blue reaches the bottom; this dye migrates at the 65 bp position).
   2. Remove the gel, and incubate with nucleic acid gel stain (see Table of Materials) in water for 10-15 min.
   3. View the gel on a "Dark Reader" trans illuminator (it is strongly recommended to avoid UV as this might damage the RNA) and cut out the library band at 150 bp. Prepare a system to elute the RNA from gel as described in step 1.5 and transfer the gel piece to the 0.5 mL tube.
   4. Centrifuge in a micro centrifuge at maximum speed for 2 min. Remove the 0.5 mL tube, which should be empty now.
   5. Add 300 µL of nuclease-free water to the 2 mL tube containing the crushed gel and rotate for at least 2 h at room temperature or at 4 °C overnight.
   6. Transfer the suspension of crushed gel pieces in water to a spin column and centrifuge for 2 min at maximum speed.
   7. Add 1 µL of (20 µg/µL) glycogen, 30 µL of 3 M NaOAc and 975 µL of ice cold 100% ethanol. Centrifuge for 20 min at max speed at 4 °C.
   8. Resuspend the pellet in 20 µL of 10 mM Tris pH8. Use 1 µL for concentration measurement and 1 µL for quality control.

4. Data analysis

NOTE: The data analysis procedure described below is based on the Linux operating system Ubuntu 16.04 LTS.

1. Treatment of raw sequence files
   1. Download the FASTQ sequence file(s) generated during the sequencing run. If required, perform demultiplexing with bcl2fastq2 (version V2.2.18.12; a manual can be downloaded from the following link: http://emea.support.illumina.com/sequencing/sequencing_software/bcl2fastq-conversion-software/documentation.html).
      Use the following command:
      nohup Pathway_of_bcl2fastq/bcl2fastq –runfolder-dir Pathway_of_Run –ignore-missing-bcl –output-dir Pathway_of_Output_Directory –barcode-mismatches 1 –aggregated-tiles AUTO -r 16 -d 16 -p 16 -w 16
   2. Remove adapter sequences using Cutadapt¹⁹ version 1.15. A manual can be downloaded here: https://cutadapt.readthedocs.io/en/stable/guide.html.
      Use the following command:
      Pathway_to_cutadapt/cutadapt -a TGGAATTCTCGGGTGCCAAGG  -n 5 -O 4 -m 10 -j 0 –nextseq-trim 10 -o Output_File_Read1_cutadapt.fastq.gz Input_File_Read1.fastq.gz
      Note that the sequence in the command corresponds to the 3’ HD adapter without the 4 random nucleotides; these will therefore not be removed during this step.
   3. Use seqtk (https://github.com/lh3/seqtk) for the removal of the terminal random nucleotides in the sequencing reads. Use the following command (variable names in bold):
      seqtk trimfq -b 4 -e 4 Output_File_Read1_cutadapt.fastq > Output_File_Read1_trimmed.fastq
   4. Use the following awk command in order to discard the sequences shorter than 10 nt:
      awk 'BEGIN {FS = "t" ; OFS = "n"} {header = $0 ; getline seq ; getline qheader ; getline qseq ; if (length(seq) >= 10) {print header, seq, qheader, qseq}}' Output_File_Read1_trimmed.fastq > Length_Filtered.fastq
2. Mapping of the trimmed sequences
   1. Download the database corresponding to the organism of study from miRBase as follows. Go to http://www.mirbase.org/ftp.shtml and download the ‘mature.fa’ file. Note that the sequences are indicated in RNA notation. Replace the U residues by T with the following command:
      sed -i '/^>/! s/U/T/g' mature.fa
      NOTE: This will yield a complete list of all miRNAs in miRBase, originating from a variety of organisms.
   2. Select the miRNA sequences of your organism of interest with the following command:
      awk 'name_of_the_organism{print; nr[NR+1]; next}; NR in nr' mature.fa > mature_name_of_the_organism_mirs.fa
   3. Map the reads to the above-created file using Bowtie2²⁰ (version 2.3.0) allowing no mismatches. First, build an index for your file with the following command:
      bowtie2-build mature_name_of_the_organism_mirs.fa mature_name_of_the_organism_mirs
   4. Align the sequencing reads to the database, requiring that a read maps entirely to a miRNA of the database, without any mismatches. To this end, use the following tool:
      bowtie2 -N 0 -L 10 –score-min C,0,0 –end-to-end –time -x mature_name_of_the_organism_mirs -U Length_Filtered.fastq -S Length_Filtered_ALIGNMENT.sam
      NOTE: The option: –score-min C,0,0 ensures that alignment is without any mismatches. For an explanation of the various parameters in the tool, please visit the following website: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
   5. To discard the reads that did not align, use the following command:
      samtools view -F 4 Length_Filtered_ALIGNMENT.sam > Reads_aligned_to_Mirs.sam
      NOTE: As a result of these steps, you should now have obtained the aligned reads, corresponding to miRNAs.