Bacterial Inner-membrane Display for Screening a Library of Antibody Fragments

1. Prepare the scFv Library as a Fusion to the ssTorA Signal Sequence

1. Obtain a deoxyribonucleic acid (DNA) library containing variants of an scFv gene.
   NOTE: The library may also be constructed using any appropriate mode to generate diversity over the entire scFv gene or targeted domains (e.g., the third complementarity determining regions, CDR3s)²².
2. Insert the DNA library into the pIMD plasmid (Figure 2) using standard molecular cloning methods²³.
   NOTE: This plasmid expresses scFvs as a genetic fusion to the ssTorA signal sequence (N-terminal to scFv) and the FLAG epitope tag (C-terminal to the scFv). The design of the plasmid for inner membrane display has been described previously¹⁹. The pIMD plasmid is available from the authors.

Figure 2. Inner-membrane display plasmid (pIMD) map (Steps 1.2 through 1.3). This plasmid contains a lac promotor, ColE1 origin of replication, and a chloramphenicol resistance gene. The inserted scFv gene is fused to the ssTorA signal sequence to target the scFv to the Tat pathway and to a FLAG epitope tag, with all three in the same reading frame. Restriction enzyme sites are indicated. For a library inserted between the XbaI and NotI restriction enzyme sites, the size of the plasmid is 2219 bp plus the size of the scFv. Please click here to view a larger version of this figure.

3. Transform the plasmid DNA containing the library into MC4100 E. coli cells²³. Recover and grow this bacterial form of the library. Centrifuge at 4,000× g for 15 min at RT to collect the cells. Remove the supernatant, and resuspend the collected cells in 25% glycerol in Luria-Bertani (LB) media. Store aliquots at -80 °C until needed, or proceed to Step 2.
   NOTE: The protocol has been verified with MC4100 cells, though other E. coli strains are also expected to be compatible with the protocol. Electroporation is the preferred method for transformation, due to its high transformation efficiency. The library should typically consist of at least 10⁹ scFv variants at this stage, and each aliquot should contain enough cells such that the library is covered 100-fold.

2. Express the Library and Prepare Spheroplasts

1. Thaw one aliquot of the bacterial library (from Step 1.3) at RT, and add the aliquot to a flask containing 100 ml LB media with 20 µg/ml chloramphenicol (Cm). Grow for 3 hr at 37 °C and 225 rpm in an incubated shaker.
2. After 3 hr, remove the flask from the 37 °C incubated shaker. Allow expression of the scFv library to proceed O/N for 15 to 22 hr at 20 °C and 225 rpm in an incubated shaker.
   NOTE: No inducer is needed when using the pIMD plasmid, as the promoter is leaky. Note that MC4100 cells do not overexpress the Lac repressor (and LacI is not found on the plasmid).

Figure 3. E.coli cells and spheroplasts. (A) E. coli cells are cylindrical in shape. (B) After spheroplasting using EDTA and lysozyme, the outer membrane of the E. coli cells is ruptured, and the resulting spheroplasts are spherical in shape. Differential interference contrast (DIC) microscopy images were obtained using a 100X objective on an inverted microscope. Please click here to view a larger version of this figure.

3. Prepare the library spheroplasts.
   NOTE: Spheroplasts are formed by rupturing the outer membrane of E. coli and are spherical in shape (Figure 3).
   1. Prepare the necessary buffers.
      NOTE: All buffers should be sterile.
      1. Prepare 1× phosphate-buffered saline (PBS; pH 7.4) by dissolving 8 g NaCl, 0.2 g KCl, 1.44 g Na₂HPO₄, and 0.24 g KH₂PO₄ in distilled H₂O to a final volume of 1,000 ml. Keep on ice.
      2. Prepare PBS with 0.1% (w/v) bovine albumin serum (BSA) by dissolving 0.2 g BSA into 200 ml 1× PBS. Keep on ice.
      3. Prepare the fractionation buffer (FB) by mixing 7.5 ml of sterile-filtered 1 M sucrose, 1 ml of 1 M Tris buffer (pH 8.0), and 1.5 ml distilled H₂O. Keep on ice.
      4. Prepare 1 mM ethylenediaminetetraacetic acid (EDTA) by adding 30 µl of 0.5 M EDTA to 14.97 ml distilled H₂O.
      5. Prepare 0.5 M MgCl₂ by dissolving 4.76 g MgCl₂ in 100 ml distilled H₂O. Keep on ice.
   2. Remove the flask from the shaker, and measure the optical density (OD) at 600 nm using a spectrophotometer to determine the cell density. Calculate the volume of induced culture needed such that each sample for spheroplasting has 1×10¹⁰ cells.
      NOTE: The approximation of an OD₆₀₀ of 1 indicating a concentration of 10⁹ cells/ml for E. coli can be used²⁴.
   3. Centrifuge the calculated volume of induced culture in a 1.5 ml microcentrifuge tube at 12,000 × g at RT for 5 min. Prepare at least two samples in the event that an issue arises in sample preparation.
   4. Remove the supernatant from the centrifuged cultures and resuspend each cell pellet in 100 µl of ice-cold FB. Centrifuge at 12,000 × g at RT for 1 min, and then remove the supernatant by pipetting. Resuspend each pellet in 350 µl of ice-cold FB supplemented with 3.5 µl of 10 mg/ml lysozyme.
   5. Slowly vortex each tube while adding, dropwise, 700 µl of 1 mM EDTA, and then incubate the tubes at RT for 20 min while slowly rotating on a tube rotator to mix the samples. Remove the tubes from the rotator, add 50 µl of ice-cold 0.5 M MgCl₂ to each tube, and incubate them on ice for 10 min. Centrifuge the tubes at 11,000 × g at 4 °C for 10 min.
   6. Isolate the spheroplast pellet.
      1. Use a micropipette with a 1 ml tip to slowly pull up part of pellet. While holding the tube at an angle with the opening directly above a new 1.5 ml tube, slowly lift the pipette tip out of the supernatant and slide the pellet into the new tube.
      2. If a significant volume of supernatant is transferred to the new tube, remove it by pipetting. If the pellet is not firm enough to transfer, re-centrifuge at 11,000 × g for 2 min and attempt pellet isolation again.
   7. Resuspend the spheroplast pellet in each tube in 1 ml of ice-cold 1× PBS. Alternate between pipetting and slowly vortexing on a vortex holder until the pellet is fully resuspended. Do not keep samples off of the ice for more than 2 min at a time, and return to the ice for at least 5 min before removing from the ice again. Keep the spheroplasts at 4 °C (for up to 2 days) until used for panning in Step 4.

3. Immobilize the Target Antigen onto Magnetic Beads

1. Biotinylate the target antigen in vivo during recombinant production in E. coli cells. Alternatively, use chemical conjugation²⁵ or purchase target antigen that has already been biotinylated, and proceed to Step 3.2.
   1. Add 816 g bicine to 50 ml water to make 10× bicine buffer. Dilute the buffer to 1× in distilled H₂O and heat to 50 °C. Add 14.7 mg biotin to 12 ml of the heated 1× bicine buffer to make a biotin solution that is 5 mM biotin in 10 mM bicine buffer. Store at -20 °C until needed.
   2. Express and biotinylate the target protein using the pAK400cb-BCCP plasmid²⁶, which allows production of the target antigen as a fusion to the biotin carboxyl carrier protein (BCCP).
      NOTE: E. coli cells natively biotinylate BCCP, eliminating the need to purify and chemically biotinylate the target protein prior to immobilization on streptavidin-coated beads. The native E. coli biotin ligase BirA is sufficient for biotinylating the fusion protein.
      1. Grow E. coli containing the biotinylation plasmid (with the target antigen inserted as a fusion to the N-terminus of BCCP) O/N for 15 to 18 hr in 5 ml of LB media supplemented with 20 µg/ml Cm at 37 °C while shaking at 225 rpm.
      2. Measure the OD at 600 nm using a spectrophotometer and calculate the volume of culture needed (V_add) to subculture at a starting OD of 0.05 in 25 ml fresh LB media with 20 µg/ml Cm using the equation: V_add = (0.05 × 25 ml)/(OD₆₀₀ – 0.05), where OD₆₀₀ is the optical density of the O/N culture and V_add is the volume of the O/N culture to add to the fresh LB. Subculture and grow to an OD of 0.5 to 0.8 in an incubated shaker at 37 °C and 225 rpm.
      3. Add isopropyl β-D-1-thiogalactopyranoside to a final concentration of 100 µM and biotin to a final concentration of 5 µM. Induce expression in an incubated shaker for 15 to 22 hr at 20 °C and 225 rpm.
   3. Harvest bacteria by centrifugation at 4,000 × g at 4 °C for 10 min. Remove the supernatant. Store the pellet at -20 °C until ready for use.
   4. Add 1 ml of a cell lysis detergent per 0.2 g of cell pellet. Resuspend by pipetting and gently rotate for 20 min to lyse the cells. After lysis, centrifuge at 16,000 × g and 4 °C for 20 min. Pipette the soluble lysate (supernatant) into a new 1.5 ml tube.
   5. Use a 3 kDa molecular weight cutoff column to remove the unbound biotin. Pipette the lysate into the column, and centrifuge at 20 °C according to the manufacturer's instructions. Wash with 1× PBS until the biotin in the lysate has been diluted 100-fold and the volume of the washed lysate is equal to the original volume of the lysate. Transfer the lysate to a new tube.
2. Immobilize the biotinylated target antigen onto streptavidin-coated magnetic beads.
   1. Prepare 1× PBS and 1× PBS with 0.1% (w/v) BSA as described in Step 2.3.1.
   2. Prepare the magnetic beads.
      NOTE: This requires the use of a magnetic separation rack.
      1. Resuspend streptavidin-coated magnetic beads in their original vial. Either vortex for at least 30 sec or rotate for 5 min.
      2. Transfer 7-10 × 10⁹ beads to a 1.5 ml tube.
         NOTE: The volume required will be dependent on the bead concentration supplied by the manufacturer.
      3. Place the tube containing the beads on the magnet rack for 2 min to collect the beads on the side of the tube. With the tube still on the magnet, carefully remove the supernatant by pipetting without disrupting the beads.
      4. To wash, remove the tube from the magnet, and resuspend the beads in 1 ml of 1× PBS by pipetting without generating bubbles. Return the tube to the magnet for 2 min to collect the beads, and carefully remove the supernatant by pipetting. Repeat the process two more times for a total of three washes. Ensure that no liquid is left in the tube after the final wash.
   3. Add the lysate containing the biotinylated antigen to the magnetic beads.
      1. Remove the tube from the magnet and resuspend the beads in 1 ml of lysate (from Step 3.1.5). Incubate at RT for 30 min while gently rotating.
      2. Place the tube on the magnet for 3 min to collect the antigen-coated beads. Wash the coated beads five times with 1× PBS with 0.1% BSA in the same manner as described in Steps 3.2.2.3 to 3.2.2.4. After the final wash, resuspend the beads in 1× PBS with 0.1% BSA up to the same volume used in Step 3.2.2.2.
      3. If the immobilized target antigen is stable at 4 °C, store the coated beads at 4 °C until needed for panning. Otherwise, proceed to Step 4.

4. Screen the scFv Library by Panning against the Target Antigen (Figure 4)

Figure 4. Panning (Step 4). Antigen-coated magnetic beads are incubated with spheroplasts expressing antibody library variants. Plasmid DNA from bead-bound spheroplasts is recovered and used to generate a sublibrary, which is screened using the ELISA-based secondary screen. Corresponding protocol steps are noted. Please click here to view a larger version of this figure.

1. Incubate the coated beads with spheroplasts.
   1. Use a spheroplast to bead ratio of approximately 5:1. Add 4 × 10⁹ spheroplasts and 8 × 10⁸ beads to a sterile 15 ml tube.
      NOTE: Assume that no cells were lost during the spheroplasting process, so the concentration is still 1 × 10¹⁰ spheroplasts/ml.
   2. Add 1× PBS with 0.1% BSA to bring the total volume to 4 ml. Aliquot into four 1.5 ml tubes with 1 ml each. Incubate the reactions at 4 °C for 5 hr while gently rotating.
2. Prepare the bead-bound spheroplasts for polymerase chain reaction (PCR).
   1. Place the panning reaction tubes on the magnet for 3 min. Remove the supernatant by pipetting, and wash the bead-bound spheroplasts four times with ice cold 1× PBS with 0.1% BSA in the same manner as described in Steps 3.2.2.3 to 3.2.2.4. Resuspend the bead-bound spheroplasts in each tube in 25 µl of distilled H₂O. Store the beads at -20 °C or proceed to Step 4.3.
3. Perform whole-plasmid PCR on bead-bound spheroplasts to amplify the plasmids containing the genes for bead-bound scFvs.
   1. Obtain primers with the following sequences: 5'CCAACTCTTTTTCCGAAGGTAACTG3' (forward primer) and 5'TAGCTCTTGATCCGGCAAACAAA3' (reverse primer).
      NOTE: These will bind end-to-end on opposite strands of the pIMD plasmid (Figure 2) and are designed to anneal to a common feature of pIMD, so amplification will occur regardless of the scFv variant sequence.
   2. Phosphorylate the primers.
      NOTE: Without phosphorylation, re-ligation will not occur. Primers may also be ordered with 5'-phosphorylation, rather than using this phosphorylation method in this protocol.
      1. In a 0.5 ml tube, set up a phosphorylation reaction for the forward PCR primer as described in Table 1. Repeat this process for the reverse primer.
      2. Incubate the reactions at 37 °C for 1 hr. Then incubate them at 65 °C for 20 min to deactivate the T4 polynucleotide kinase (PNK). Store the phosphorylated primers at -20 °C.
   3. Perform PCR.
      1. In a PCR tube, prepare the PCR reaction as described in Table 2.
         NOTE: Multiple reactions can be prepared for higher yield. The unused bead-bound spheroplasts can be stored at -20 °C.
      2. Heat the PCR reactions at 98 °C for 15 min in a thermal cycler to ensure full lysis of the spheroplasts. Remove the tubes from the thermal cycler, and add 0.5 µl of a high fidelity polymerase to each. Return tubes to the thermal cycler and run using the program detailed in Table 3.
      3. Pool the PCR products as appropriate. Store at -20 °C or proceed to Step 4.4.

Table 1. PNK phosphorylation reaction (Step 4.3.2.1).

Table 2. Whole-plasmid PCR reaction (Step 4.3.3.1).

Table 3. PCR program (Step 4.3.3.2).

4. Re-circularize the whole-plasmid PCR products, and use the ligated product to transform MC4100 E. coli cells.
   1. Purify the PCR product by running the PCR reaction on an agarose gel²³, staining the DNA in the gel²³, and using a gel cleanup kit to purify the linearized plasmid by following the instructions supplied by the manufacturer. Measure the concentration using a spectrophotometer at 260 nm. Store the purified fragment at -20 °C until needed, or continue to Step 4.4.2.
   2. Re-circularize plasmid from the PCR product.
      1. To prevent intermolecular ligation of the PCR product, carry out the ligation reaction with a low concentration²⁷ of 1 ng/µl of PCR product. Calculate the volume needed for preparing an 800 µl ligation reaction at this concentration.
      2. Prepare the ligation reaction on ice. In a tube, add the volume calculated in Step 4.4.2.1 of the PCR product, 80 µl of 10× DNA ligase buffer, and distilled H₂O up to 800 µl. Add 4 µl of T4 DNA ligase, and immediately place tubes at 16 °C in a water bath or thermal cycler. Incubate at 16 °C O/N for 14 to 18 hr. Store the completed ligation reactions at -20 °C until needed, or proceed to Step 4.4.3.
   3. Place the ligation reaction on a heat block at 65 °C for 15 min to heat-inactivate the DNA ligase. Then use a microdialysis membrane or DNA cleanup kit to de-salt the ligated DNA. Store at 20 °C or proceed to Step 4.4.4.
   4. Use the entire heat-inactivated, de-salted ligation product to transform MC4100 E. coli cells²³. Prepare glycerol stocks, as described in Step 1.3, of the cells containing the resulting panned sublibrary, and store aliquots at -80 °C.
5. Repeat Step 4 in its entirety using an aliquot from Step 4.4.4 to do a second panning on the sublibrary.
   NOTE: A second panning helps enrich for library constituents that bind well to the target antigen¹⁹.

5. Perform a Secondary Screen Using an Enzyme-linked Immunosorbent Assay Method to Identify Promising Clones for Further Characterization (Figure 5)

Figure 5. ELISA-based secondary screening (Step 5). (A) Library variants from the sublibrary enriched during panning are inoculated in individual wells of a culture plate for growth and expression. (B) An ELISA plate is coated with target antigen. (C) The library variants are screened using the ELISA-based secondary screen described in the protocol. Upon analysis of data obtained from the secondary screen, variants of interest are selected and characterized further. Corresponding protocol steps are noted. Please click here to view a larger version of this figure.

1. Thaw one tube of the panned sublibrary (from Step 4.4.4) and plate onto LB agar plates. Plate several dilutions at concentrations low enough to ensure individual colonies (e.g., 10²– to 10⁶-fold dilutions). Incubate the plates for 15 to 18 hr at 37 °C. Store the plates at 4 °C or proceed to Step 5.2.
2. Culture and induce colonies from the panned sublibrary. Perform all the steps under sterile conditions. Use a multichannel pipettor for steps involving 96-well plates.
   1. Add 200 µl of LB with 20 µg/ml Cm into each well of a round-bottom 96-well culture plate.
   2. Pick an individual colony from the agar plate with a pipette tip, place the tip in the first well of the 96-well plate, and gently stir to inoculate. Use a new tip for each well. Inoculate one colony into each well. As a control, include at least one sterility control well with no colony inoculated.
   3. Repeat Steps 5.2.1 and 5.2.2 to inoculate several 96-well plates.
   4. Place the 96-well plates on a microplate shaker at 310 rpm. Incubate at 37 °C for 20 to 24 hr to express the scFvs.
3. For each culture plate prepared in Step 5.2, coat one 96-well ELISA plate with the target antigen.
   1. Dilute purified target antigen to an appropriate concentration (e.g., 1 µg/ml to 4 µg/ml) in 1× PBS to make the coating solution. Make 5 ml of coating solution for each 96-well plate.
      NOTE: The appropriate concentration depends on the specific antigen being used and may need to be adjusted.
   2. Add 50 µl of the coating solution to each well of a 96-well high-binding clear polystyrene ELISA plate. Gently tap the plate on the benchtop surface to ensure that the entire surface of each well is coated. Repeat for each plate. Incubate the plates at 4 °C O/N.
4. Replicate the colonies from the 96-well culture plates onto agar plates.
   1. Place a sterile polystyrene replicator into the wells of a culture plate to collect a small amount of liquid. Carefully raise the replicator and transfer to a 15 cm LB agar plate such that all tips are touching the plate. Once the liquid has transferred, lift the replicator straight up. Repeat for each culture plate.
   2. Label the agar plate with the correct orientation so that results from the secondary screen in the 96-well plate can be matched with the correct replicated colony on the plate, if further characterization is desired. Grow at 37 °C for 15 to 18 hr, and then store at 4 °C until needed.
5. Perform the ELISA secondary screen.
   1. Prepare the blocking solution by making 2% (w/v) dry milk in 1× PBS. Empty the coating solution from the ELISA plates. Add 100 µl of the blocking solution to each well. Incubate at RT for at least 2 hr, or block O/N at 4 °C.
   2. Prepare the wash buffer by adding polysorbate 20 to a final concentration of 0.05% in 1× PBS. Make 250 ml per ELISA plate.
   3. Add 20 µl of a concentrated cell lysis detergent to each well of the round-bottom culture plate, and incubate the culture plate on a microplate shaker at RT for 15 to 20 min. Begin the lysis at the same time that the blocking of the ELISA plates is complete so that the lysis and the wash Step 5.5.4 can be performed concurrently.
   4. Empty the blocking solution from the ELISA plates. Wash the blocked ELISA plates four times with 200 µl of wash buffer per well per wash. Empty the wash buffer from the wells.
   5. Transfer 50 µl from each well of the cell lysis plate to the corresponding well of the ELISA plate, using a new tip for each well. Incubate the ELISA plate at RT for 1 to 2 hr.
   6. Prepare the antibody solution to detect bound scFvs.
      1. Use a horseradish peroxidase (HRP)-conjugated primary antibody that binds to the FLAG epitope tag fused to the library scFvs.
      2. Dilute the antibody to the appropriate dilution to use in an ELISA (see supplier's recommendations) in 2% (w/v) dry milk in 0.05% polysorbate 20 in 1× PBS. Prepare 5 ml for each plate.
   7. Wash the ELISA plates four times with wash buffer as described in Step 5.5.4.
   8. Add 50 µl of the antibody solution to each well of the ELISA plate. Incubate for 1 to 2 hr at RT.
   9. Prepare the HRP substrate by dissolving o-phenylenediamine dihydrochloride (OPD) tablets in distilled H₂O per the manufacturer's protocol while avoiding light. Prepare 20 ml per ELISA plate.
   10. Prepare 3 M H₂SO₄ by diluting concentrated H₂SO₄ with distilled H₂O as necessary. Prepare 5 ml per ELISA plate.
       Caution: H₂SO₄ is a strong acid. Be sure to wear appropriate personal protective equipment.
   11. Wash the ELISA plates four times with wash buffer, as described in Step 5.5.4.
   12. Incubate ELISA plates with the HRP substrate.
       1. Add 200 µl of the HRP substrate to each well. To minimize light exposure, add the substrate to one ELISA plate at a time, and wrap with aluminum foil before proceeding to the next plate. Incubate the plates for 30 to 60 min at RT in the dark.
       2. After the first 30 min, check the plates for darkening of the substrate, and incubate longer if needed to visualize developing color.
   13. Add 50 µl of 3 M H₂SO₄ to each well to quench the reaction. Using a different tip for each well, mix the solution in the wells by gently pipetting up and down without frothing. For consistency and to prevent saturation, add the H₂SO₄ quickly and carefully to all of the ELISA plates prior to mixing the solution for each plate.
   14. Measure the absorbance of the solution in the wells of each plate at 492 nm using a plate reader.
   15. Analyze the absorbance data to identify scFv variants that exhibit promising binding signals and characterize these promising scFvs. Select scFvs that exhibit absorbance signals higher than the background signal and higher than the average signal on each plate.
       NOTE: The absorbance level will be dependent on the properties of the antigen and anti-FLAG antibody used, along with the strength of the scFv variants that were isolated in the screening.