Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Hirofumi Nishizono; Mohamed Darwish; Hideki Uosaki; Nanami Masuyama; Motoaki Seki; Hiroyuki Abe; Nozomu Yachie; Ryohei Yasuda

doi:10.3791/60808

JoVE Journal > Genetics

Genetica

Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice

Published: April 02, 2020

doi:

10.3791/60808

Hirofumi Nishizono*^1,2,3, Mohamed Darwish*^4,5, Hideki Uosaki^6,7, Nanami Masuyama^8,9,10, Motoaki Seki^8,11, Hiroyuki Abe³, Nozomu Yachie^8,9,10,12,13, Ryohei Yasuda¹

¹Max Planck Florida Institute for Neuroscience, ²Life Science Research Center,University of Toyama, ³Department of Biochemical Engineering, Graduate School of Science and Engineering,Yamagata University, ⁴Graduate School of Innovative Life Science,University of Toyama, ⁵Department of Biochemistry, Faculty of Pharmacy,Cairo University, ⁶Division of Regenerative Medicine, Center for Molecular Medicine,Jichi Medical University, ⁷Division of Stem Cell Research and Drug Development, Center for Development of Advanced Medical Technology,Jichi Medical University, ⁸Synthetic Biology Division, Research Center for Advanced Science and Technology,University of Tokyo, ⁹Institute for Advanced Biosciences,Keio University, ¹⁰Graduate School of Media and Governance,Keio University, ¹¹Department of Molecular Oncology, Graduate School of Medicine,Chiba University, ¹²Department of Biological Sciences, School of Science,University of Tokyo, ¹³College of Arts and Sciences,University of Tokyo

Summary

Here, we present a modified method for cryopreservation of one-cell embryos as well as a protocol that couples the use of freeze-thawed embryos and electroporation for the efficient generation of genetically modified mice.

Abstract

The use of genetically modified (GM) mice has become crucial for understanding gene function and deciphering the underlying mechanisms of human diseases. The CRISPR/Cas9 system allows researchers to modify the genome with unprecedented efficiency, fidelity, and simplicity. Harnessing this technology, researchers are seeking a rapid, efficient, and easy protocol for generating GM mice. Here we introduce an improved method for cryopreservation of one-cell embryos that leads to a higher developmental rate of the freeze-thawed embryos. By combining it with optimized electroporation conditions, this protocol allows for the generation of knockout and knock-in mice with high efficiency and low mosaic rates within a short time. Furthermore, we show a step-by-step explanation of our optimized protocol, covering CRISPR reagent preparation, in vitro fertilization, cryopreservation and thawing of one-cell embryos, electroporation of CRISPR reagents, mouse generation, and genotyping of the founders. Using this protocol, researchers should be able to prepare GM mice with unparalleled ease, speed, and efficiency.

Introduction

The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system is a scientific breakthrough that provides unprecedented targeted modification in the genome¹. The CRISPR/Cas9 system is comprised of Cas9 protein and guide RNA (gRNA) with two molecular components: a target-specific CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA)² . A gRNA directs the Cas9 protein to the specific locus in the genome, 20 nucleotides complementary to crRNA, and adjacent to the protospacer adjacent motif (PAM). The Cas9 protein binds to the target sequence and induces double-strand breaks (DSBs) that are repaired by either error-prone nonhomologous end joining (NHEJ) or high fidelity homology-directed repair (HDR)³^,⁴^,⁵. The NHEJ leads to insertions or/and deletions (indels), and hence to gene loss of function when a coding sequence is targeted. The HDR leads to precise genome editing in the presence of a repair template containing homology sequences³^,⁴^,⁵. The NHEJ and HDR have been harnessed to generate knockout and knock-in mice, respectively.

While the CRISPR/Cas9 system has markedly accelerated the generation of GM mice with outstanding efficacy and fidelity, scientists who apply these methods often encounter technical challenges. First, conventional protocols require microinjection for introducing the CRISPR editing tools into the pronucleus of fertilized eggs⁶^,⁷. This technique is time-consuming and usually requires extensive training. Thus, several groups replaced microinjection with electroporation⁸^,⁹^,¹⁰^,¹¹^,¹²^,¹³. However, in the early electroporation protocols fresh embryos were used for electroporation. This caused another problem, because preparing fresh embryos before each experiment is difficult¹⁴.

Recently we and others have combined the use of freeze-thawed embryos and electroporation for genome editing, which facilitates the generation of GM mice¹⁵^,¹⁶. This protocol enables researchers without advanced embryo manipulation skills to rapidly generate animal models of human diseases with high efficiency. The protocol also significantly reduces practical challenges in generating GM mice, such as genetic heterogeneity in the founders¹⁶. To overcome mosaicism, we perform the electroporation of CRISPR reagents within 1 h after embryo thawing to ensure that editing occurs before the first replication of the genome. Another improvement includes the use of Cas9 protein instead of Cas9 mRNA to reduce undesirable mosaicism¹⁷. Furthermore, we developed an optimal method for one-cell embryo cryopreservation that increases the developmental rate to the two-cell stage¹⁶: use of fetal bovine serum (FBS) dramatically improves the survival of freeze-thawed oocytes after fertilization, perhaps by the same mechanism that makes freeze-thawed unfertilized oocytes more resilient¹⁸.

Here we present a comprehensive protocol for the generation of GM mice using freeze-thawed embryos, including the modified method for cryopreservation of one-cell C57BL/6J embryos. It includes 1) gRNA design, CRISPR reagent preparation and assembly; 2) IVF, cryopreservation, and thawing of one-cell embryos; 3) Electroporation of CRISPR reagents into freeze-thawed embryos; 4) Embryo transfer into the oviduct of pseudopregnant female mice; and 5) Genotyping and sequence analysis of the F0 founder animals.

Protocol

All animal care and procedures performed in this study were undertaken according to the rules and regulations of the Guide for the Care and Use of Laboratory Animals. The experimental protocol was approved by the Animal Care Committee of Laboratory Animals of University of Toyama, University of Tokyo, Jichi University, and Max Planck Florida Institute for Neuroscience. Information about all reagents is showed in the Table of Materials.

1. CRISPR reagents design

crRNA design
1. Visit CRISPR direct¹⁹ (https://crispr.dbcls.jp/) to design specific crRNAs with reduced off-target sites.
  NOTE: There are many other useful tools to design the crRNA²⁰ (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
2. Insert the target nucleotide sequence and make the following changes:
  PAM sequence requirement = NGG
  Specificity check = Mouse (Mus musculus) genome, GRCm38/mm10 (Dec, 2011)
  NOTE: As an example, to generate Tyrosinase (Tyr) knockout mice, exon 2 (nucleotide sequence from 9476–9692) was targeted.
3. Click Design, and for highly specific hits, mark Show Highly Specific Target Only.
4. To reduce potential off-target effects, choose the target sequence with the lowest value in the columns of "12 mer+PAM" and "8 mer+PAM".
  NOTE: In these columns, ("1") indicates that the sequence has only one perfect match with the intended target site and numbers greater than one indicate the presence of potential off-target sites.
5. Order the resulting oligonucleotides from crRNA synthesis companies (Supplimentary Table 1).
  NOTE: For the exon 2 Tyr gene, the following target sequence was used: GGACCACTATTACGTAATCC, with +TGG as the PAM sequence (Figure 2A).
Single strand oligodeoxynucleotide (ssODN) design for HDR-mediated editing experiments (i.e., knock-in mice generation).
1. Design the ssODN length to be around 80–180 bp including 30–60 nucleotide (nt) homology arms on both sides.
  NOTE: An ssODN of 75–85 nt length, including a 30–35 nt homology arm and complementary to the gRNA, showed high knock-in editing efficiency²¹.
2. Insert the intended modification and silent mutation at the PAM sequence or, if not possible, at the 5′ neighboring base of PAM to block the recutting after genome editing.
  NOTE: The crRNA and ssODN used in this study are listed in Supplementary Table 1.

2. In vitro fertilization, embryo cryopreservation, and freeze-thawing

In vitro fertilization
1. Superovulate C57BL/6J female mice (4 or 8-weeks-old) by IP injection with pregnant mare serum gonadotropin (PMSG) followed by injection with 7.5 IU human chorionic gonadotropin (hCG) after 48 h.
  NOTE: The number of ovulated oocytes can be increased by about 3x using ultra-superovulation²².
2. Remove the cauda epididymides from sexually mature C57BL/6J male mice (3–5-months-old).
  NOTE: It is possible to collect spermatozoa without sacrificing the male mice.
3. Extract clots of spermatozoa with a dissecting needle and incubate them in a 200 µL drop of human tubal fluid (HTF) in CO₂ incubator for 1.5 h for capacitation.
4. Collect cumulus-oocyte complexes (COCs) from the oviducts 16–18 h after the hCG injection and incubate them in a fresh 200 µL drop of HTF medium covered with paraffin liquid in a CO₂ incubator (5% CO₂, 37 °C) for no more than 2 h.
  NOTE: It is preferable to sacrifice the mice by cervical dislocation under anesthesia because euthanasia via CO₂ inhalation affects IVF and embryo development²³.
5. Add 1–5 µL of sperm suspension from the boundary of the incubation medium to the 200 µL drop of HTF medium containing COCs and incubate them in a CO₂ incubator for 3 h.
6. Wash the oocytes with potassium-supplemented simplex optimization medium (KSOM) 3x to remove remaining sperm and cumulus cells.
7. Check the pronuclear formation and the grade of one-cell embryos using an inverted microscope.
Cryopreservation of one-cell embryos
1. Incubate one-cell embryos in a 200 µL drop of HTF containing 20% FBS (not covered with paraffin liquid) for 10 min in a CO₂ incubator.
2. Transfer 20–100 embryos to 50 µL of 1 M dimethyl sulfoxide (DMSO) solution²⁴.
3. Transfer 5 µL of a solution containing 100 embryos into the bottom of a cryotube and cool for 5 min at 0 °C using a chiller or on ice.
4. Add 45 µL of DAP213 (2 M dimethyl sulfoxide, 1 M acetamide, and 3 M propylene glycol) solution slowly along the tube wall, cap the tubes, and keep for 5 min in a chiller or on ice at 0 °C.
  NOTE: Do not fasten the caps too tightly to remove them easily during sample thawing.
5. Store tubes rapidly in liquid nitrogen.
Embryo thawing
1. Open the lid of the cryotube, discard the remaining liquid nitrogen, and add 900 µL of 0.25 M sucrose solution preheated to 37 °C.
  NOTE: The 0.25 M sucrose solution must be warmed to 37 °C in advance because the use of cold solution decreases embryo viability after thawing.
2. Pipet quickly for 10x and transfer the contents of the cryotube into a plastic dish.
  NOTE: The pipetting should be performed carefully, so that no bubbles are generated and damage the embryos.
3. Wash the morphologically normal fertilized oocytes 2x in KSOM medium covered with paraffin liquid and keep them in a CO₂ incubator until electroporation.

3. Assembly and electroporation of CRISPR reagents

NOTE: For electroporation, we used a platinum plate electrode (height: 0.5 mm, length: 10 mm, width: 3 mm, gap: 1 mm) and a one-step type electroporator that were described previously⁸ (Table of Materials). A two-step type electroporator can be used too (Table of Materials).

Preparation and assembly of CRISPR reagents
1. Order CRISPR reagents (i.e., crRNA, tracrRNA, and Cas9 protein) and ssODN if performing HDR-mediated editing experiments (Table of Materials and Supplementary Table 1).
2. Prepare the annealing solution as follows.
  1. Prepare 1 μg/µL crRNA and 1 μg/µL tracrRNA in Reduced-Serum Minimal Essential Medium solution (Table of Materials), and add 6 µL of each solution to 42 µL of the nuclease-free buffer.
  2. Incubate the mixture in the dry heater at 95 °C for 3 min and cool at RT for 5 min.
  3. Prepare 1 μg/µL HiFi Cas9 protein diluted in Opti-MEM I and add 6 µL to the previous mixture for a total volume of 60 µL.
  4. In performing HDR-mediated editing experiments, add 6 µL of 1 μg/µL ssODN. Because the final volume should be 60 µL, use 36 µL of nuclease-free water in step 3.1.2.1.
    NOTE: The final concentration of crRNA, tracrRNA, Cas9 protein, and ssODN will be 100 ng/µL.
  5. Transfer up to 100 embryos to 25 µL of the final mixture (RNP complex) in a one hole slide glass and incubate them at 37 °C for 10 min.
Electroporation
1. Fill the electrode gap with 6 µL of the new mixture of CRISPR reagents and add 20–25 embryos to the mixture.
  NOTE: It is important to avoid any contact between the embryos and the electroporation electrode, which can damage embryos during electrical pulses.
2. Perform the electroporation at the following conditions for an one-step type electroporator:
  Voltage: 25 V, Pulse direction (Pd) +
  ON: 3 ms, OFF: 97 ms
  Repeats: 5x
  NOTE: Electroporation should be performed no more than 1 h after thawing to ensure genome editing occurs before the first DNA replication to prevent mosaicism.
3. For a two-step type electroporator, set the conditions as follows:
  Poring Pulse = 40V, Pd +
  ON = 1 or 2.5 ms; Pulse interval = 50 ms
  Repeats: 4x, Decay 10%
  
  Transfer Pulse = 5 or 7V; Pd +/-.
  ON: 50 ms; Pulse interval = 50 ms.
  Repeats = 5x; Decay = 40%.
  NOTE: It is important to adjust the volume in order to maintain impedance within the specific range specified by the manufacturer.
4. Wash the embryos 3x with modified Krebs-Ringer Bicarbonate Buffer 2 (M2) medium followed by two washes with a drop of KSOM medium covered with paraffin liquid.
5. Incubate the washed embryos (in KSOM medium) in a CO₂ incubator overnight for further transplantation.

4. Embryo transfer

Prepare pseudopregnant female mice. Mate ICR female mice (3–6 months) with vasectomized male mice 1 day before the embryo transfer (ET).
NOTE: Mice should be checked the next morning for a copulatory plug. The mice with a plug are considered pseudopregnant and can be used for ET.
Aspirate air and KSOM (without paraffin liquid) in alternate intervals of 2–3 mm into a glass capillary as a marker for successful implantation.
Introduce 20–24 embryos into a 200 μL drop of KSOM (without paraffin liquid) and draw 10–12 embryos into the glass capillary for implantation in each oviduct.
Anesthetize the female mice by isoflurane (inhalation) or an IP injection of a solution combining medetomidine/midazolam/butorphanol (0.3 mg/kg, 4.0 mg/kg, and 5.0 mg/kg respectively). Position the anesthetized mouse on its ventral side on a heating pad. Protect the eyes of the anesthetized mouse with a moisturizing gel.
Shave along the lower part of the dorsal midline and disinfect the area with povidone iodine followed by with 70% ethanol.
Make a long ~1 cm incision parallel to the dorsal midline.
Take out the oviduct and place on a sterile plastic drape. Keep it moist using warm sterile saline.
Place the oviduct under the stereoscopic microscope.
Make a hole into the wall of the oviduct between the infundibulum and ampulla a few millimeters upstream of the ampulla by microspring scissors.
Insert the tip of the glass capillary containing the embryos into the hole and blow gently into the mouthpiece of the capillary holder to expel the embryos until an air bubble is visible in the ampulla.
NOTE: Transfer between 10–12 embryos per oviduct.
Withdraw the glass capillary from the oviduct wall and push the reproductive organ gently back into the body cavity.
Repeat the previous process to introduce the embryos into the other oviduct.
Upon completing the ET procedure, suture the peritoneum with a simple interrupted suture pattern (50, absorbable, braided synthetic sutures) and then the skin with a simple interrupted pattern or a buried subcuticular interrupted stitch pattern (60 nonabsorbable, monosynthetic sutures).
Keep the mouse warm on a 37 °C warming plate until it recovers from anesthesia.
Monitor the health of the animal daily for 7 days after surgery.

5. Genotyping and sequence analysis

Genomic DNA extraction
NOTE: We used NucleoSpin tissue DNA extraction kits to extract the genomic DNA from mice ear tissue following the manufacturer’s recommendations.
1. Add 180 µL of Buffer T1 and 25 µL of Proteinase K solution to the sample and mix by vortexing for 10 s.
2. Incubate at 56 °C for 2 h or until complete lysis is obtained. Vortex for 10 s every 30 min of the incubation.
3. Add 200 µL of Buffer B3, vortex vigorously for 30 s, and incubate at 70 °C for 10 min.
4. Add 210 µL of 100% ethanol to the sample and vortex vigorously.
5. For each sample, place one tissue column into a collection tube and apply the sample to the column.
6. Centrifuge for 1 min at 11,000 x g, discard the flowthrough, and place the column back into the collection tube.
7. Add 500 µL of Buffer BW to wash the sample (1st wash), centrifuge for 1 min at 11,000 x g, discard the flowthrough and place the column back into the collection tube.
8. Add 600 µL of Buffer B5 to the column (2nd wash), centrifuge for 1 min at 11,000 x g, discard the flowthrough, and place the column back into the collection tube.
9. Centrifuge the column for 1 min at 11,000 x g to dry the silica membrane and place the NucleoSpin tissue column into a 1.5 mL microcentrifuge tube.
10. Add 100 µL of Buffer BE, incubate at room temperature for 1 min, then centrifuge 1 min at 11,000 x g.
PCR amplification and purification
1. Design the primers using the primer3 plus website (https://primer3plus.com/) in order to amplify a 400–500 bp sequence surrounding the targeted locus.
2. Design a new PCR protocol and test it empirically.
3. Purify the PCR product to remove the unwanted enzymes, nucleotides, primers, and buffer components. A standard purification method can be used as follows.
  1. Add 50 µL of phenol to 50 µL of the PCR products and mix by vortexing.
  2. Centrifuge for 1 min at 11,000 x g and transfer the upper transparent layer to a new tube.
  3. Add 120 µL of 99.5% ethanol and 20 µL of 5 M ammonium acetate and vortex for 30 s.
  4. Keep at RT for 10 min and centrifuge at 11,000 x g for 10 min.
  5. Discard the supernatant and wash the DNA pellet with 1 mL of 70% ethanol.
  6. Dry the pellet at RT for 10 min and dissolve in 10 µL of RNase free water.
    NOTE: PCR column-based purification kits are recommented because phenol is toxic to humans.
Sanger sequencing
1. Run DNA quantification analysis (see Table of Materials) to quantify the purified PCR amplicon.
2. Send PCR product(s) and sequencing primer(s) to a sequencing service provider.
3. Analyze the sequence using the available online websites.
  NOTE: In this study, CRISP-ID²⁵ (http:/crispid.gbiomed.kuleuven.be/) was used for sequence analysis.

Representative Results

Our modified method for cryopreservation of one-cell embryos, including incubation in HTF containing 20% FBS for 10 min followed by cryopreservation in 1 M DMSO and DAP213 solution, improved the developmental rate of the freeze-thawed embryos into the two-cell stage (Figure 1, p = 0.009, Student’s t-test).The freeze-thawed embryos were used for the production of GM mice and electroporation conditions were optimized: five repeats of 25 V with 3 ms pulses and 97 ms intervals using an electroporator as described in the Protocol section. The applicability of the protocol was checked by generation of albino Tyrosinase gene (Tyr) knockout mice (Figure 2). To do so, gRNA targeting exon 2 was designed (Figure 2A) and CRISPR reagents were prepared as described in the Protocol section. The editing tools were electroporated within 1 h of embryo thawing to ensure genome editing occurred before the first replication of the genome and thus prevented mosaicism in the founders (Figure 2B). All the generated mice were albino, and only one mouse was mosaic, with a coat with white and black patches (Figure 2C). All the albino mice harboring two different mutant alleles (heterozygous mutation) except one mouse harboring only one allele (homozygous mutation) are shown in Figure 2E. It can be concluded that our method can provide an editing efficiency of near 100% with a low mosaic rate as confirmed by sequencing analysis as well as coat color (Figure 2C–E).

Next, the reproducibility of the protocol was checked by the generation of several lines of knockout and knock-in mice. As shown in Table 1, the protocol can generate knockout and knock-in mice with high efficiency and low mosaic rates. Most of the generated F0 mice were mated with wild type C57BL/6J mice to confirm the germline transmission of mutant alleles to the F1 generations. As anticipated, all the F1 offspring of the homozygous F0 mice were heterozygous, containing one mutant allele and one wild type allele. No disparate mutations were observed between genotyping of the founders and their generations. The described protocol generated GM mice within a short time (i.e., ~4 weeks) as shown in the workflow of the protocol in Figure 3.

Figure 1: Fetal bovine serum (FBS) improved the two-cell stage developmental rate of the freeze-thawed embryos. The number of FBS+ embryos was 286 (the experiment was repeated 3x), and the number of FBS- embryos was 272 (the experiment was repeated 3x). Data are presented as mean ± SEM. This figure is reproduced from Darwish M et al.¹⁶ with permission. Please click here to view a larger version of this figure.

Figure 2: Generation of Tyr knockout mice with high efficiency and low mosaic rate. This figure is modified from Darwish M et al.¹⁶ with permission. (A) Schematic illustration showing the design of gRNA. The PAM sequence is shown in red. (B) Illustration showing the timing of electroporation for the freeze-thawed embryos, the yellow symbol represents electroporation time. (C) Representative images of the generated Tyr knockout mice. (D) Sequence analysis of different alleles of the Tyr knockout mice. The target sequence is labeled in red and dashes indicate the deletion of nucleotides in the mutant alleles. WT = wild type M = mutant allele. (E) A representative part of the chromatogram of the albino mouse containing the M1 allele is shown in D. Please click here to view a larger version of this figure.

Figure 3: Workflow of the protocol for the generation of GM mice. The first step was the preparation of cryopreserved embryos. Female C57BL/6J mice were superovulated, first by PMSG injection, then 48 h later by hCG injection. COCs were collected 16 h later and subjected to IVF with spermatozoa collected from male C57BL/6J mice. Fertilized oocytes were cryopreserved and stored in liquid nitrogen until needed. The second step included thawing the embryos and electroporation. Cryopreserved embryos were thawed and CRISPR reagents (i.e., tracrRNA, crRNA, and Cas9 protein) were assembled and electroporated within 1 h after thawing the embryos. The third step included embryo transfer and the birth of mice. The day after electroporation, two-cell embryos were transferred to the oviduct of pseudopregnant female mice to generate genetically modified mice that were later genotyped using Sanger sequencing to confirm the editing efficiency. The time and effort required for preparing fertilized oocytes before every experiment (step 1) can be shortened if a large number of cryopreserved embryos is prepared in advance. This figure is adapted from Darwish M et al.¹⁶ Please click here to view a larger version of this figure.

Mutant mice	Electroporated embryos	2-cell embryos	Transferred embryos	Pups (%)	Mutant mice(%)	No of mosaic mice
Tyr KO	124	84	48	12 (25)	100	1
Glrb KO	151	94	40	6 (15)	100	0
Slc39a6 KO	48	25	25	5 (20)	100	0
Bag3 KI	233	84	20	3 (15)	50	1
Camk2a KI	124	70	70	14 (20)	64.3	0

Table 1: Production of several lines of GM mice using freeze-thawed embryos of C57BL/6J background.

Supplementary Table 1. Please click here to download this table.

Discussion

The described protocol allows for the generation of GM mice with high efficiency and low mosaic rates (Table 1). It enables researchers without advanced embryo manipulation skills to create mutant mice easily because it takes advantage of the latest and most useful advances in both reproductive engineering and genome editing technologies: CRISPR/Cas9 ribonucleoprotein (RNP) and electroporation into freeze-thawed embryos. These advances facilitated and expedited the generation of the GM mice. As described in Figure 3, it takes ~4 weeks to generate the GM mice. Compared to other protocols using similar approaches²⁶, our method is superior in terms of the efficiency, birth rate, and mosaicism.

The incubation of one-cell embryos in FBS before the cryopreservation is critical for improving the developmental rate of the embryos. The electroporation conditions of the cryopreserved embryos, described in the Protocol, allow a compromise between the editing efficiency of CRISPR reagents and the survival of the embryos. Indeed, harsher or milder conditions may affect the developmental rate of the embryos and the editing efficiency, respectively¹⁶. The timing of the electroporation (Figure 2B) is critical to overcome the mosaicism in founders and ensure that genome modification occurs in the presence of only two alleles. This is consistent with previous reports showing that early-stage electroporation could produce non-mosaic mutants¹⁷. In addition, the use of RNP instead of gRNA/mRNA decreases mosaic rate and improves editing efficiency¹⁷.

The described protocol features several advantages. First, it generates the mutant mice within a short time (~4 weeks). Second, it is a highly efficient and robust protocol; several lines of knockout (KO) and knock-in (KI) mice were generated with high mutation rates (KO = 100%, KI = 50 to 64.3%). Third, it is convenient and cost-effective. The use of complete synthetic crRNA, tracrRNA, ssODN, and Cas9 protein eliminates the need for tedious preparation of the Cas9 vectors and in vitro transcription. Instead, it allows researchers to simply use commercial reagents and standard equipment. Fourth, it does not use microinjection, which requires high technical skills. Fifth, it reduces the mosaicism in founders, and thus leads to more efficient germline transmission of the edited alleles, overcoming the complicated genotypic analysis of the mosaic mice. Finally, this protocol is efficient with the C57BL/6J inbred strain, which avoids the use of F1 hybrids, and thus the need to perform numerous backcrosses to get rid of genetic complexity. The genotyping of F1 generations confirmed accurate germline transmission. However, it is not recommended to study the phenotypes of the F0 mice due to allele complexity and the misleading prediction of genotyping of subsequent generation extrapolated from the genotyping of F0 founders¹⁴^,²⁷.

It is of prime importance to harness the use of the freeze-thawed embryos in the genome editing of nonhuman primates and large animals such as pigs and sheep, which are not always readily available. The methods of embryo freezing differ greatly depending on the animal species. Therefore, we think our cryopreservation protocol might be only applicable to mice. On the other hand, our protocol is potentially applicable to use engineering nucleases other than Cas9 for the generation of GM mice, because electroporation has been previously reported to introduce other nucleases such as Cas12a into the embryo efficiently²⁸^,²⁹.

One limitation of the protocol is the precise integration of a long transgene into the genome, which is considered difficult in electroporation-based protocols. However, one potential solution was reported: the integration of transgenes up 4.9 Kb in the mouse genome was successfully performed by combining electroporation with an adeno-associated virus (AAV)-mediated HDR donor delivery system³⁰, confirming an earlier publication³¹. Also, the potential occurrence of off-target side effects is a major concern with the use of CRISPR/Cas9 technology. We have not performed whole-genome sequencing of the edited mice to exclude the potential off-target effect. However, we have used CRISPR tools that have been reported to reduce the off-target effect, such as RNP³². Moreover, we used a high-fidelity Cas9 variant that significantly reduces off-target editing without sacrificing on-target performance³³. Also, we designed gRNAs using CRISPRdirect software (https://crispr.dbcls.jp), which should result in target sequences with minimized off-target sites¹⁹. To confirm the genotype-phenotype causality and alleviate the concerns about off-target effects, researchers should generate several edited mice of the same genotype using different gRNAs or perform backcrossing of the generated mice for several generations.

The knockout mice generated using the NHEJ mechanism and frameshift mutations have been widely used and show relevant phenotypes. However, truncated residual protein may exist due to either translation reinitiation or skipping of the edited exon³⁴^,³⁵. Therefore, to precisely interpret the phenotypes, characterization of residual protein function or expression is necessary. The generation of complete gene knockout mice using more than one gRNA would be a good alternative. However, particular attention should be paid to confirm that the gene does not contain intronic regions transcribed to noncoding RNAs, which might have regulatory functions and hence complicate the phenotypic analysis.

In this study, we show a simple protocol by which many researchers can generate genetically modified mice in 4 weeks or less. By combining the use of freeze-thawed embryos and electroporation, we render the preparation of mouse models of human diseases easy, quick, and efficient.

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

We wish to thank Hitomi Sawada and Elizabeth Garcia for animal care. This work was supported by KAKENHI (15K20134, 17K11222, 16H06276 and 16K01946) and Hokugin Research Grant (to H.N.), and Jichi Medical University Young Investigator Award (to H.U.). The Otsuka Toshimi Scholarship Foundation supported M.D.

Materials

0.25 M Sucrose	ARK Resource Co., Ltd. (Kumamoto, Japan)	SUCROSE
1 M DMSO	ARK Resource Co., Ltd. (Kumamoto, Japan)	1M DMSO
Butorphanol	Meiji Seika Pharma Co., Ltd. (Tokyo, Japan)	Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS	Integrated DNA Technologies, Inc. (Coralville, IA)	1081060
C57BL/6J mice	Japan SLC (Hamamatsu, Japan)	N/A
DAP213	ARK Resource Co., Ltd. (Kumamoto, Japan)	DAP213
FBS	Sigma-Aldrich, Inc. (St. Louis, MO)	ES-009-C
hCG	MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan)	HCG Mochida 3000
HTF	ARK Resource Co., Ltd. (Kumamoto, Japan)	HTF
ICR mice	Japan SLC (Hamamatsu, Japan)	N/A
Isoflurane	Petterson Vet Supply, Inc. (Greeley, CO)	07-893-1389
KSOM	ARK Resource Co., Ltd. (Kumamoto, Japan)	KSOM
LN2 Tank	Chart Industries (Ball Ground, GA)	XC 34/18
M2	ARK Resource Co., Ltd. (Kumamoto, Japan)	M2
Medetomidine	Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan)	1124401A1060
Microscope	Nikon Co. (Tokyo, Japan)	SMZ745T
Midazolam	Sandoz K.K. (Tokyo, Japan)	1124401A1060
Nuclease free buffer	Integrated DNA Technologies, Inc. (Coralville, IA)	1072570
Nucleospin DNA extraction kit	Takara Bio Inc (Kusatsu, Japan)	740952 .5
One-hole slide glass	Matsunami Glass Ind., Ltd. (Kishiwada, Japan)	S339929
One-step type Electroporator	BEX Co., Ltd. (Tokyo, Japan)	CUY21EDIT II
Paraffin Liquid	NACALAI TESQUE Inc. (Kyoto, Japan)	SP 26137-85
Platinum plate electrode	BEX Co., Ltd. (Tokyo, Japan)	LF501PT1-10, GE-101
PMSG	ASKA Animal Health Co., Ltd (Tokyo, Japan)	SEROTROPIN 1000
Povidone iodide	Professional Disposables International, Inc. (Orangeburg, NY)	C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I	Sigma-Aldrich, Inc. (St. Louis, MO)	22600134
Two-step type Electroporator	Nepa Gene Co., Ltd. (Ichikawa, Japan)	NEPA21

Riferimenti

Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153 (4), 910-918 (2013).
Jinek, M., et al. A programmable dual-RNA – guided DNA endonuclease in adaptive bacterial immunity. Science. 337 (6096), 816-822 (2012).
Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339 (6121), 823-826 (2013).
Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339 (6121), 819-823 (2013).
Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346 (6213), 1258096 (2014).
Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Biologia dello sviluppo. 393 (1), 3-9 (2014).
Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10 (11), 1-7 (2015).
Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetica. 200 (2), 423-430 (2015).
Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291 (28), 14457-14467 (2016).
Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13 (6), 1253-1274 (2018).
Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15 (1), 1-10 (2015).
Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Biologia dello sviluppo. 418 (1), 1-9 (2016).
Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55 (2), 136-139 (2005).
Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31 (7), 1120-1123 (2015).
Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioingegneria. 6 (3), 63 (2019).
Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10 (5), 1-11 (2015).
Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86 (7), 825-834 (2019).
Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87 (2), 479-483 (1989).
Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67 (4), 535-543 (2018).
Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54 (9), 777-784 (2012).
Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28 (5-6), 525-535 (2019).
Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27 (13), 3780-3789 (2019).
Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24 (8), 1216-1224 (2018).
Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28 (21), 3422-3429 (2018).
Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).

Play Video

PDF

DOI

DOWNLOAD MATERIALS LIST

Citazione di questo articolo

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).