Recombinant Protein Expression, Crystallization, and Biophysical Studies of a <em>Bacillus</em>-conserved Nucleotide Pyrophosphorylase, BcMazG

Meong Il Kim; Choongdeok Lee; Minsun Hong

doi:10.3791/55576

JoVE Journal > Biochemistry

Biochimica

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Published: May 16, 2017

doi:

10.3791/55576

Meong Il Kim¹, Choongdeok Lee¹, Minsun Hong¹

¹Division of Biological Science and Technology,Yonsei University

Summary

Bacillus anthracis is the obligate pathogen of fatal inhalational anthrax, so studies of its genes and proteins are strictly regulated. An alternative approach is to study orthologous genes. We describe biophysicochemical studies of a B. anthracis ortholog in B. cereus, bc1531, requiring minimal experimental equipment and lacking serious safety concerns.

Abstract

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis is an obligate pathogen that causes fatal inhalational anthrax. Bacillus cereus is considered a useful model for studying B. anthracis due to its close evolutionary relationship. The gene cluster ba1554 – ba1558 of B. anthracis is highly conserved with the bc1531– bc1535 cluster in B. cereus, as well as with the bt1364-bt1368 cluster in Bacillus thuringiensis, indicating the critical role of the associated genes in the Bacillus genus. This manuscript describes methods to prepare and characterize a protein product of the first gene (ba1554) from the gene cluster in B. anthracis using a recombinant protein of its ortholog in B. cereus, bc1531.

Introduction

Recombinant protein expression is widely used to overcome problems associated with natural protein sources, such as limited protein quantities and harmful contamination. Moreover, in studies of pathogenic genes and proteins, an alternative laboratory strain that does not require additional safety precautions can be utilized. For example, Bacillus cereus is a useful model for studying Bacillus anthracis due to their close evolutionary relationship¹.

B. anthracis is an obligate pathogen that causes fatal inhalational anthrax in humans and livestock and can potentially be used as a bioweapon². Thus, laboratory studies on B. anthracis are strictly regulated by the US Centers for Disease Control, requiring biosafety level 3 (BSL-3) practices, which mandate that the laboratory area be segregated with negative room pressure. In contrast to B. anthracis, B. cereus is categorized as a BSL-1 agent and thus has minimal safety concerns. B. cereus is an opportunistic pathogen that, upon infection, causes food poisoning that can be treated without medical assistance. However, because B. cereus shares many critical genes with B. anthracis, the functions of B. anthracis proteins can be studied using the corresponding homologs of B. cereus¹.

The ba1554 – ba1558 gene cluster of B. anthracis is highly conserved with the bc1531– bc1535 cluster of B. cereus, as well as with the bt1364-bt1368 cluster of Bacillus thuringiensis, in terms of gene organization and sequence. Furthermore, the first genes (ba1554, bc1531, and bt1364) of the respective clusters are absolutely conserved (i.e., 100% nucleotide sequence identity), implying a critical role of the gene product in the Bacillus species. Due to its location in these gene clusters, ba1554 was misidentified as a putative transcription regulator³. However, amino acid sequence analysis of the ba1554 product indicates that it belongs to the MazG family, which has nucleotide pyrophosphohydrolase activity and is not associated with transcription factor activity⁴^,⁵. Although proteins belonging to the MazG family are diverse with respect to overall sequence and length, they share a common ~100-residue MazG domain characterized by an EXXE_12-28EXXD motif ("X" stands for any amino acid residue, and the number indicates the number of X residues).

The MazG domain does not always directly account for a certain catalytic activity. A MazG member from Escherichia coli (EcMazG) possesses two MazG domains, but only the C-terminal MazG domain is enzymatically active⁶. Moreover, the substrate specificity of MazG enzymes varies from non-specific nucleoside triphosphates (for EcMazG) to specific dCTP/dATP (for integrin-associated MazG) and dUTP (for dUTPases)⁶^,⁷^,⁸^,⁹. Therefore, biophysicochemical analyses of the BA1554 protein are necessary to confirm its NTPase activity and to decipher its substrate specificity.

Here, we provide a step-by-step protocol that most laboratories without a BSL-3 facility can follow to characterize the protein product of the B. cereus bc1531 gene, which is an ortholog of B. anthracis ba1554, at the molecular level. Briefly, recombinant BC1531 (rBC1531) was expressed in E. coli and purified using an affinity tag. For X-ray crystallographic experiments, the crystallization conditions of the rBC1531 protein were screened and optimized. To assess the enzymatic activity of rBC1531, NTPase activity was monitored colorimetrically to avoid radioactively labeled nucleotides that have been conventionally used. Finally, analyses of the obtained biophysicochemical data enabled us to determine the oligomerization state and catalytic parameters of rBC1531, as well as to obtain X-ray diffraction data from the rBC1531 crystal.

Protocol

1. Recombinant Protein Production and Purification of rBC1531

Preparation of a recombinant BC1531 protein (rBC1531)-expression plasmid
1. Prepare genomic DNA of B. cereus¹⁰.
2. Amplify the bc1531 gene from a template of B. cereus genomic DNA by polymerase chain reaction (PCR), using forward and reverse primers (see the Materials List) to create BamHI and SalI restriction enzyme sites, respectively¹⁰.
3. Digest the PCR product and a modified pET49b vector (pET49bm) using BamHI and SalI, as described¹¹.
4. Mix the digested PCR product and vector (3:1 ratio) from step 1.1.3 using T4 DNA ligase in a 10 µL reaction, as described¹¹. Incubate at 18 °C for 30 min.
5. Pipette 3 µL of the ligation reaction into 50 µL of chemically competent E. coli DH5α cells in a tube. Mix gently by pipetting up and down and place on ice for 30 min. Heat shock for 45 s at 42 °C. Add 1 mL of Luria-Bertani (LB) medium and grow the cells while vigorously shaking (250 rpm, 37 °C, 45 min).
6. Take 100 µL of the transformed cells from step 1.1.6 and spread them onto the LB-agar plates with 100 µg/mL kanamycin (Kan). Incubate for ~18 h at 37 °C.
7. Pick colonies using a sterile tip and grow the cells in 3 mL of LB medium with 100 µg/mL Kan; shake vigorously (250 rpm, 37 °C, 18 h).
8. Prepare plasmid DNA using an alkaline-SDS lysis method, as described¹⁰.
9. Confirm the nucleotide sequence of the rBC1531-expression construct using DNA sequencing¹².
Overexpression of the rBC1531 protein
1. Re-transform the E. coli BL21 (DE3) strain with rBC1531-expression plasmid, as described in steps 1.1.5-1.1.6, for overexpression.
2. Select a colony and grow it in 10 mL of LB medium containing 50 µg/mL Kan (LB+Kan); shake vigorously for 18 h at 37 °C.
3. Inoculate 10 mL of overnight culture in 1 L of LB+Kan medium and grow at 37 °C until the OD₆₀₀ (optical density at 600 nm) reaches ~0.7.
4. Submerge the culture in ice-cold water for ~15 min to cool down the temperature to 18 °C and add isopropyl β-D-1-thiogalactopyranoside (IPTG) to the culture at a final concentration of 1 mM for recombinant protein expression. Grow the culture at 18 °C for an additional ~16-18 h.
Purification of rBC1531
1. Harvest the cells by centrifugation (5,000 x g, 4 °C, 30 min). Discard the supernatant carefully so as to not disturb the cells. Re-suspend the cells in 50 mL of phosphate-buffered saline (PBS) solution containing 10 mM imidazole.
2. Lyse the cells twice by sonication on ice to prevent the over-heating of the cell lysates (time: 2 min 30 s; cycle on: 5 s; cycle off: 10 s; amplitude: 38%).
3. Clear the cell lysate by centrifugation (~25,000 x g, 4 °C, 30 min).
4. Mix 3 mL of nickel beads and 60 mL of PBS containing 10 mM imidazole and gravity-flow the extra buffer to settle the equilibrated nickel beads in a 2.5 x 10 cm glass chromatography column.
5. Pipette to transfer the supernatant from step 1.3.3 to the column with pre-equilibrated nickel beads and incubate at 4 °C for 2 h on a spinning wheel at a low speed (~20 rpm).
6. Allow the supernatant to drain by gravity and wash the nickel beads in the column three times with 100 mL of PBS containing 10 mM imidazole.
7. Elute rBC1531 protein by applying 4 x 5 mL of PBS containing 250 mM imidazole.
8. Take 15 µL of the elution from step 1.3.7 and run it on 15% SDS-PAGE. Visualize the protein bands on the gel using Coomassie blue staining¹⁰.
Removal of the affinity tags of the rBC1531 protein by thrombin proteolysis
1. Pipette the fractions into dialysis tube (molecular weight cut off: 3 kDa) and place the tube in a beaker containing 4 L of thrombin cleavage-compatible buffer (20 mM HEPES, pH 7.4, 150 mM NaCl, and 1.5 mM β-mercaptoethanol) at 4 °C overnight.
2. Pipette the fractions and transfer them to a conical tube.
3. Measure the absorbance at 280 nm and estimate the rBC1531 protein concentration, as described¹³.
4. Take 50 µg of rBC1531 in a 0.5 mL tube and add various amounts of thrombin (i.e., 2, 1, 0.6, and 0.3 units). Incubate the rBC1531 and thrombin reactions at 20 °C for ~3 h to determine the least amount of thrombin required to cleave the N-terminal affinity tag.
5. Run the rBC1531 and thrombin reactions on a 15% SDS-PAGE and determine the lowest amount of thrombin (e.g., 0.3 units of thrombin per 50 µg of rBC1531) that completely digests the N-terminal affinity tag and produce a tag-free rBC1531.
6. Add 10 mg of rBC1531 protein and 60 units of thrombin to a 15 mL tube and incubate at 20 °C for ~3 h for the thrombin-proteolysis reaction.
7. Apply gel-filtration standards to a size-exclusion chromatography (SEC) column to prepare a standard curve of molecular weights and elution volumes, as described¹³.
8. Place the thrombin-digested rBC1531 protein from step 1.4.6 in a centrifugal filter tube (molecular weight cut off: 3 kDa) and centrifuge at 3,000 g at 4 °C to reduce to a volume of less than 5 mL.
9. Apply the concentrated rBC1531 protein to the SEC column and collect 60 eluted fractions in 0.5 mL per tube¹³.
10. Take 15 µL of each fraction, run them on a 15% SDS-PAGE, and stain the gel using Coomassie staining solution (0.15% (w/v) Coomassie brilliant blue, 40% (v/v) methanol, and 10% (v/v) glacial acetic acid) as described¹⁰.
11. Pipette the fractions that contain rBC1531 and collect them in one tube.

2. Crystallization Screening and Optimization of rBC1531

Screening conditions for rBC1531 protein crystallization
1. Concentrate the rBC1531 from step 1.4.11 up to ~18.5 mg/mL using a centrifugal filter tube, as described in step 1.4.8.
2. Add 50 µL of each crystallization screening solution (see section 2.2)¹⁴ to the wells of 96-well sitting-drop crystallization plates. Place 0.5 µL of the 18.5 mg/mL rBC1531 protein solution on a sitting bed. Mix the protein solution with 0.5 µL of the well solution, repeating the process for the entire plate.
3. Cover the plate with clear adhesive film. Place the 96-well plates at 18 °C and allow for vapor diffusion.
4. Scan the drops at 20-40X magnification using a light microscope to monitor crystal formation daily for 2-3 weeks.
5. Collect X-ray diffraction data¹² using the obtained rBC1531 protein crystals.
Optimization of rBC1531 crystallization conditions
1. Prepare 500 µL of the selected initial crystallization condition solution (e.g., 0.1 M sodium cacodylate, pH 6.5 and 1.0 M sodium citrate) and fill a 24-well crystallization plate for the sitting drop.
2. Add 0.5 µL of the 18.5 mg/mL rBC1531 protein solution to a sitting bed, mix with 0.5 µL of the well solution, and cover the plate immediately with clear adhesive film. Place the plate at 18 °C.
3. Observe crystal growth under a light microscope for a week.
4. Optimize various crystallization conditions by varying the pH (i.e., pH 5.5-6.8) of 0.1 M cacodylate and by altering the salt concentration (i.e., 0.9-1.2 M) of sodium citrate to obtain singular crystals. Monitor crystal growth for ~1 week and collect X-ray diffraction data¹².

3. Characterization of the Nucleoside Triphosphatase (NTPase) Activity of rBC1531

Validation of the inorganic phosphate-dependent colorimetric study
1. Prepare a stock of pyrophosphate (100 mM) and dilute it to final concentrations of 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100, and 250 µM in 200 µL of reaction buffer (20 mM HEPES, pH 7.4; 150 mM NaCl; and 2 mM MgCl₂) in duplicate 96-well plates. Use the first plate as a control (this does not contain pyrophosphatase). Ensure that the second plate contains pyrophosphatase as a working plate, as directed in step 3.1.2.
2. Add 0.01 unit of Saccharomyces cerevisiae inorganic pyrophosphatase (1 µL) to the wells of the working plate and incubate at 20 °C for 30-60 min.
3. Prepare molybdate acid solution by mixing ammonium molybdate (0.86% v/v) and ascorbic acid (14% v/v) solutions in a 7:3 ratio. Add 16 µL of molybdate acid solution to both the working and control wells and wait for 15 min.
4. Read the optical density at 690 nm (OD_690nm).
Colorimetric NTPase assay
1. Prepare a stock of 100 mM nucleoside triphosphate (NTP) substrate and dilute to the desired concentration (e.g., 0, 0.2, 4.4, 11, 22, 44, 88, or 132 µM) in 180 µL of assay buffer (20 mM HEPES, pH 7.4; 150 mM NaCl; and 2 mM MgCl₂).
2. Add 20 µg of rBC1531 (1.5 mM) and the NTP substrates from step 3.2.1 up to 200 µL per reaction in a 96-well plate and pipette up and down to mix well. Cover the plate with its lid and place it in a 37 °C incubator for 30 min to perform the substrate hydrolysis reaction.
3. Transfer the plate to a 70 °C water bath and allow to stand for 15 min to stop rBC1531-mediated catalytic reactions.
4. Add 0.01 unit of S. cerevisiae inorganic pyrophosphatase (1 µL) to each well of the reaction plate (from step 3.2.3) and incubate at 20 °C for 30 min. Add 16 µL of molybdate acid solution to the reaction plate to develop the color (~15 min). Read at OD_690nm.
5. Analyze using the Michaelis-Menten equation, as described¹².

Representative Results

Characterization of the protein of interest in this study began by preparing a sufficient quantity of recombinant B. cereus bc1531 (rBC1531) protein, preferably more than several milligrams. The DNA fragment encoding the BC1531 protein was prepared by PCR using the genomic DNA of B. cereus as a template, as it contains orthologous genes identical to ba1554. rBC1531 was overexpressed as a soluble protein in E. coli cells. The rBC1531 protein was expressed with a 6x-Histidine tag and a thrombin cleavage site at its N-terminus¹². As a first step of purification, rBC1531 was purified by nickel-affinity chromatography (Figure 1A). Next, a thrombin digestion trial was performed to determine the lowest amount of thrombin required for the complete digestion of the affinity tag from rBC1531 (Figure 1A). In our hands, 0.3 units of thrombin was sufficient to completely remove the affinity tag from rBC1531. Thus, when scaling, 10 mg of rBC1531 was treated with 60 units of thrombin for tag removal. After thrombin digestion, the tag-free rBC1531 was applied to a SEC column to remove any soluble aggregates and higher- or lower-molecular weight contaminants. The rBC1531 fractions were analyzed by SDS-PAGE, the results of which suggested that rBC1531 was ~99% pure (Figure 1A). Overall, 1 L of culture yielded ~8 mg of rBC1531 protein.

To estimate the oligomeric status of rBC1531, SEC was performed. A standard linear curve that correlates the log value of the molecular weights of the samples with their corresponding elution volumes was plotted using the peaks of the protein standards (Figure 1B). rBC1531 was eluted at an elution volume of ~84 mL, and its apparent molecular weight was estimated as ~55 kDa. Given that the calculated molecular weight of the rBC1531 monomer is ~13 kDa, these results indicate that rBC1531 assembles as a tetramer.

Purified rBC1531 was screened for crystallization using ~400 conditions in a sitting-drop vapor diffusion method. The rBC1531 crystals appeared in ~2 days at two conditions: condition-A, 0.1 M sodium citrate (pH 5.5) and 20% PEG 3000 (Figure 2A) and condition-B, 0.1 M sodium cacodylate (pH 6.5) and 1.0 M sodium citrate (Figure 2B). The crystallization conditions were optimized by varying the pH (0.1 M sodium citrate, pH 5.0-6.0) and the concentration of PEG 3000 (18-21% PEG 3000) from condition-A and by modifying the pH (0.1 M sodium cacodylate, pH 5.5-6.8) and salt concentration (0.9-1.2 M sodium citrate) from condition-B. Diffraction-suitable crystals were obtained only for condition-B, whereas the crystals from condition-A tended to be inter-grown rather than singular. Condition-B crystals diffracted X-rays to a resolution of 2.74 Å (Figure 2C) and were used for rBC1531 structure determination.

The observation of a conserved MazG domain in the BA1554 protein sequence suggested the presence of NTPase activity capable of hydrolyzing NTPs. NTP hydrolysis generally yields nucleoside diphosphate (NDP) and inorganic phosphate (Pi), or nucleoside monophosphate (NMP) and pyrophosphate (PPi). PPi requires additional pyrophosphatase activity to yield Pi. Levels of Pi can be directly measured using molybdate, which forms a blue-colored complex with Pi (molybdate-Pi) that can be monitored using the optical density at a wavelength of 690 nm (OD_690nm) (Figure 3A). In our study, after NTP hydrolysis by rBC1531, no visible blue color was produced after adding molybdate (Figure 3B). However, when pyrophosphatase was added to the rBC1531-mediated NTP hydrolysis reaction, the color changed to deep blue (Figure 3B), indicating that rBC1531 has NTP pyrophosphohydrolase activity. A plot of the OD_690nm and NTP concentration was analyzed using a non-linear regression method to determine the kinetic parameters (V_max of 0.75 and K_mof 10 µM) for the rBC1531 enzyme (Figure 3C).

Figure 1: SDS-PAGE and size-exclusion chromatography (SEC) analysis. (A) SDS-PAGE analysis of rBC1531. (Left) The rBC1531 elution peaks from nickel affinity chromatography (lane 2, Ni) and SEC (lane 3) were analyzed along with protein standards (lane 1; labeled in kDa). (Right) Analysis of the thrombin digestion of rBC1531 for the removal of the affinity tag. The amounts of thrombin added to 50 µg of rBC1531 in different reactions are indicated in units above the gel. (B) Size-exclusion chromatography (SEC) analysis of rBC1531 and the protein standards. (Left) Elution profiles of rBC1531 (blue) and standards (red). Molecular weights of the standard proteins are shown above each peak, in kDa. The vertical (y) and horizontal (x) axes show the milli-absorption units (mAU at 280 nm) and retention volumes (mL), respectively. (Right) The apparent molecular size of rBC1531 was estimated using a linear plot for the molecular weights, in log scale, and elution volumes of protein standards (R² = 0.9934). Please click here to view a larger version of this figure.

Figure 2: Crystallization and X-ray diffraction. (A) rBC1531 crystals in condition-A, 0.1 M sodium citrate (pH 5.5) and 20% PEG 3000. (B) rBC1531 crystals in condition-B, 0.1 M sodium cacodylate (pH 6.5) and 1.0 M sodium citrate. Initial (left) and optimized (middle and right) crystals are shown. The optimized rBC1531 crystal (right, ~0.35 mm x ~0.35 mm x ~0.20 mm) was used for X-ray diffraction. Scale bars = 100 µm. (C) X-ray diffraction image of the rBC1531 crystal obtained at the PAL beamline BL-7A¹². The arrow indicates a high-resolution spot. Please click here to view a larger version of this figure.

Figure 3: NTPase activity. (A) The formation of the molybdenum-Pi complex is dependent on Pi concentration. Optical density at 690 nm is directly associated with increase in Pi levels. The Y-axis and X-axis represent the OD_690nm and concentration (µM) of Pi, respectively. (B) Color changes upon the addition of pyrophosphatase. In the first row of wells, pyrophosphatase was not added and did not form the blue-colored Pi-complex. However, the second row consists of wells in which the rBC1531-NTP reactions were treated with pyrophosphatase and developed a blue color. OD_690nm values increased with increase in NTP concentrations. (C) Michaelis-Menten plot of the rBC1531-NTP reactions. The Y-axis and X-axis represent the OD_690nm and concentration (0-120 µM) of NTP substrates, respectively. The error bars represent the standard deviation for three separate experiments. Please click here to view a larger version of this figure.

Discussion

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving from a gene to a purified recombinant protein. Using recombinant protein, biophysical characterization analyses were conducted to reveal that tetrameric rBC1531 catalyzes NTP hydrolysis into NMP and PPi.

SEC was employed as the last step of protein purification to remove any protein contaminants derived from the cell lysates that have different sizes than rBC1531. A SEC column was also used to determine the oligomerization status of rBC1531, which was a tetramer. The crystal structure of rBC1531 was consistently determined to be tetrameric¹².

Among biophysical techniques, X-ray crystallography is the best technique for generating atomic models of protein. In general, three-dimensional singular crystals with dimensions larger than 0.1 mm are required for X-ray diffraction. To obtain X-ray diffraction-suitable crystals, crystallization conditions were optimized. For rBC1531, two conditions produced crystals in the initial screening, but only one condition was useful for producing diffraction-suitable crystals¹².

The NTP hydrolysis activity of rBC1531 was assessed by monitoring the formation of a blue-colored complex of molybdate and Pi in the rBC1531-mediated enzymatic reaction¹⁵. It has the great advantage of non-radioactively detecting NTP hydrolysis, since the molybdate-Pi complex can be optically measured. In the rBC1531 reaction, the blue-colored complex was generated only in the presence of pyrophosphatase, demonstrating that rBC1531 hydrolyzes NTP into NMP and pyrophosphate. Furthermore, because the blue color of the molybdate-Pi complex can be detected with the naked eye, Pi levels in the rBC1531 reaction, as well as in other applications, can be easily assessed in pilot experiments. Moreover, kinetic parameters, such as K_m and V_max can be calculated by quantifying the intensity of the colorimetric reaction using a visible-light spectrophotometer. However, the presences of free phosphate in the reaction buffer or precipitation during the enzymatic reaction would impair the attainment of accurate results from the NTP hydrolysis reactions. Thus, it is desirable to prepare a Pi standard curve using the identical reaction buffer as in the NTP hydrolysis runs and to ensure an increase in optical density only in the presences of Pi.

Given that the K_m value of the rBC1531-NTP was low (K_m = 10 µM), the true substrate for rBC1531 may be a specific type of canonical or noncanonical (d)NTP. To test this possibility, the experimental conditions can be modified to use a specific NTP (i.e., ATP, GTP, CTP, or UTP) rather than a mixture of NTPs. By comparing kinetic parameters, substrate specificity can be determined in future applications. Indeed, additional studies indicate that BC1531 prefers ATP¹². Despite the technical simplicity of the colorimetric assay using the molybdate reaction, this assay has a drawback in that the color can become randomly intense when the blue-colored molybdate-Pi complex is left at neutral pH for an extended period of time. Therefore, a critical step is to perform measurements within 15-30 min after the molybdate is added to the Pi-containing sample. The experiment is repeated using the same time point to avoid variations in OD measurements.

In conclusion, various biophysicochemical methods were used to analyze the oligomerization state and enzymatic activity of rBC1531 and to prepare diffraction-quality crystals for structural studies. These methods can be safely and easily applied to other proteins of interest with minimal experimental equipment requirements.

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

The X-ray diffraction datasets were collected at beamline 7A of the Pohang Accelerator Laboratory (Korea). This study was supported by the Basic Science Research Program administered through the National Research Foundation of Korea (NRF), funded by the Ministry of Science, ICT & Future Planning (2015R1A1A01057574 to MH).

Materials

Bacillus cereus ATCC14579	Korean Collection for Tissue Culture	3624
Genomic DNA prep kit	GeneAll	106-101	Genomic DNA preparation
Forward primer	Macrogen	GAAGGATCCGGAAGCAAAAA CGATGAAAGATATGCA	BamHI site is underlined
Reverse primer	Macrogen	CTTGTCGACTTATTCTTTCTCT CCCTCATCAATACGTG	SalI site is underlined
nPfu-Forte	Enzynomics	P410	PCR polymerase
BamHI	Enzynomics	R003S
SalI	Enzynomics	R009S
pET49b expression vector	Novagen	71463	Expression vector was modified to add affinity tags and BamHI/SalI sites¹⁰
T4 DNA ligase	Enzynomics	M001S
Dialysis memebrane	Thermofisher	18265017
Dry block heater	JSR	JSBL-02T
LB broth (Luria-Bertani)	LPS solution	LB-05
LB Agar, Miller (Luria-Bertani)	Becton, Dickinson and Company
Kanamycin	LPS solution	KAN025
Mini-prep kit	Favorgen	FAPDE300	Plasmid DNA preparation
BL21(DE3) Competent cell	Novagen	69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG)	Fisher BioReagents	50-213-378
Sodium chloride	Daejung	7548-4100	PBS material
Potassium chloride	Daejung	6566-4405	PBS material
Potassium phosphate	Bio Basic Inc	PB0445	PBS material
Sodium phosphate	Bio Basic Inc	S0404	PBS material
Imidazole	Bio Basic Inc	IB0277
Sonicator	Sonics	VCX 130
Ni-NTA agaros	Qiagen	30210	Nickel bead
Rotator	Finepcr	AG
Precision Plus Protein Dual Color Standards	Bio-rad	1610374	SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250	Fisher BioReagents	BP101-25	Coomassie staining solution
Methyl alcohol	Samchun chemical	M0585	Coomassie staining solution
Acetic acid	Daejung	1002-4105	Coomassie staining solution
Dialysis memebrane	Thermofisher	68035
2-Mercaptoethanol	Sigma-aldrich	M6250
Thrombin	Merckmillipore	605157-1KUCN	Prepare aliquots of 20 μl (1 Unit per μl) and store at 70 °C and thaw before use
Superdex 200 16/600	General Electric	28989335	Size exclusion chromatography
Gel filtration standard	Bio-rad	151-1901
Centrifugal filter	Amicon	UFC800396
Crystralization plates	Hampton research	HR3-083	96-well sitting drop plate
The JCSG core suite I-IV	Qiagen	130924-130927	Crystallization secreening solution
Microscope	Nikon	SMZ745T
Cryschem plates	Hampton research	HR3-158	24-well sitting drop plate
Inorganic pyrophosphatase	Sigma	10108987001
Ammonium molybdate solution	Sigma	13106-76-8
L-ascorbic acid	Sigma	50-81-7
NTP substrate	Startagene	200415-51
Spectrophotometer	Biotek	SynergyH1	microplate reader
GraphPad Prism 5	GraphPad	Prism 5 for Window

Riferimenti

Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
Gross, M., Marianovsky, I., Glaser, G. MazG — a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
Green, M., Sambrook, J. . Molecular cloning: A laboratory Manual. 1, (2012).
Brown, T. A. . Gene cloning an introduction. , (1986).
Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
Sheehan, D. . Physical biochemistry: Principles and applications. , (2009).
Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).

Play Video

PDF

DOI

DOWNLOAD MATERIALS LIST

Citazione di questo articolo

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).