Development of Metarhizium anisopliae as a Mycoinsecticide: From Isolation to Field Performance

1. Isolation of Entomopathogenic Fungi

1. Soil dilution method
   1. Collect the soil samples and mycosed insects from different crop fields (Table 1). Isolate the entomopathogenic fungi from soil samples using the soil dilution plating method⁸.
      Note: In this study, samples were collected from the Pune (18°31'13''N; 73°51'24''E) and Buldhana (19°58'36''N 76°30'30''E) districts, Maharashtra, India.
   2. Weigh 10 g of each soil sample and add them separately to 90 mL of sterile 0.1% (w/v) Tween-80.
   3. Thoroughly mix the samples using a magnetic stirrer for 60 min to release the spores adhered to soil particles.
   4. After mixing, spread 100- to 200-µL aliquots from each sample onto selective medium containing (g/L): peptone, 10; glucose, 20; agar, 18; streptomycin, 0.6; tetracycline, 0.05; cyclohexamide, 0.05; and dodine, 0.1 mL; pH 7.0⁹. Incubate the plates at 28 °C for 3-7 days.
   5. Select and subculture the individual sporulating colonies on the same medium to obtain pure cultures.
2. From mycosed insects
   1. Collect the mycosed insects from the field.
      Note: A hard larval body is likely to be infected with entomopathogenic fungus. With bacterial or viral infection, the dead insect body is soft.
   2. Collect live insects with abnormal behavior, poor coordination, and jerky movements.
   3. Keep the insects until death and then transfer them to moist chambers for further mycosis and sporulation, if any, at 28 °C and 70-80% RH.
   4. Streak the spores from the sporulating cadavers on the abovementioned selective medium and obtain pure cultures by further subculturing 2-3 times on the same medium.
3. Bait method
   1. In a vial (3.85 x 6.0 cm) containing 60 g of soil sample, add 4 rice moth larvae (Corcyra cephalonica) and keep the vials at 25 ± 2 °C for a period of 14 days.
   2. Turn the vials upside down every day. After 14 days, screen the soil samples for the presence of mycosed rice moth larvae. Isolate the entomopathogenic fungus by streaking spores from sporulating cadavers on selective medium.
   3. After obtaining pure cultures, transfer the isolates to potato dextrose agar (PDA) slants and incubate at 28 °C and 70-80% RH for 7 days to allow sporulation. Following sporulation, maintain the mother cultures at 8 °C until use.

2. Identification of Entomopathogenic Fungi

1. Identify entomopathogenic fungi by observing morphological characteristics, (i.e., asexual spore size and shape and the arrangement of the spores on conidiophores); isolates of 3 main genera, Metarhizium, Beauveria, and Nomuraea, can be identified.
2. For the molecular identification of Metarhizium strains, extract the genomic DNA from the mycelial biomass using a DNA isolation kit; follow the manufacturer's instructions (see the Table of Materials). Check the quality of genomic DNA by performing electrophoresis on a 0.8% agarose gel.
   1. PCR-amplify the ITS1-5.8S-ITS2 and 26S rDNA region. Use genomic DNA as a template, with ITS1 forward (TCCGTAGGTGAACCTGCGG) and ITS4 reverse (TCCTCCGCTTATTGATATGC) primers¹⁰.
   2. Gel-elute and purify the expected-size amplicons using a gel extraction kit; follow the manufacturer's instructions (see the Table of Materials). Quantify the purified amplicon and sequence.
   3. Read and edit the sequences using the software and perform a BLAST search of the nucleotide sequences in the NCBI GenBank data library to analyze the close homology¹¹.
   4. Deposit the sequences of identified entamopathogenic isolates to the NCBI GenBank database to retrieve the accession numbers.

3. Screening of Metarhizium Isolates Against H. armigera

1. Insect rearing
   1. Establish the initial culture of H. armigera by collecting healthy larvae and pupae of the insect from the field.
   2. For rearing, grow the larvae individually in sterile polypropylene vials (3.85 x 6.0 cm, 50-mL capacity) containing pieces of okra disinfected with 0.5% (v/v) sodium hypochlorite for 10 min¹².
   3. Collect the insect eggs laid during rearing and surface-sterilize them with 0.5% (v/v) sodium hypochlorite.
   4. Maintain the larvae at 25 ± 2 °C and 65 ± 5% RH.
2. Insect bioassay
   Note: For the insect bioassay, the production of spores, and field performance studies, the first subcultures of Metarhizium strains from mycosed H. armigera larvae were used, unless otherwise noted.
   1. For the insect bioassays, use III-instar larvae of H. armigera.
   2. Dip a set of 30 larvae in triplicate individually into a 10-mL spore suspension of Metarhizium isolates (1 x 10⁷ spores/mL, unless otherwise mentioned; viability > 90%) for 5 s.
   3. After treatment, transfer each larva individually to a separate, sterile vial to avoid cannibalism. To each vial, add moist Whatmann filter paper No. 1 and a piece of disinfected okra as feed. Change the paper and feed on alternate days.
   4. Keep the larvae at 25 ± 2 °C, 65 ± 5% RH, and 16:8 light: dark for 14 days or until they die.
   5. Transfer the dead larvae to sterile Petri plates containing moist cotton swabs and keep them at 28 °C and 70-80% RH for 3-7 days to allow mycelia and spore formation over the cadavers.
   6. For a control, treat a set of 30 larvae in triplicate with 0.1% (w/v) Tween-80 in sterile distilled water.
   7. Conduct all experiment in triplicate using freshly prepared spore suspensions. Collect and pool the data on percent mortality from three experiments to get average values. Calculate the corrected percent mortality using Abbott's formula¹³.
   8. Perform the experiments using a randomized complete block design (RCBD) layout, with each treatment containing a set of 30 larvae in triplicate. Based on percent mortality against H. armigera, select Metarhizium isolates for further screening of the best isolate for commercial production.
   9. Select the isolates demonstrating >90% mortality against H. armigera III-instar larvae.
      Note: Here, 12 isolates were selected.
   10. Determine the LT₅₀ of these isolates and select the isolates demonstrating the fastest killing (in less time).
       Note: Here, 5 isolates were selected from the 12 most potent isolates.
   11. Determine the LC₅₀ values of the selected isolates using four different concentrations (i.e., 1 × 10³, 1 × 10⁵, 1 × 10⁷, and 1 × 10⁹ spores/mL) of spore suspension.
   12. Determine the LC₅₀ of the Metarhizium isolates against III-instar larvae of H. armigera to increase the possibility of identifying the difference in virulence of isolates with high mortality values that might go undetected if only a single dose is used.

4. Production of Spores of a Metarhizium Isolate for Field Performance Studies

1. Production of Metarhizium spores by SSF
   1. For SSF, prepare the inoculum by adding 2 x 10⁷ spores of the Metarhizium isolates to 200 mL of YPG (0.3% yeast extract, 0.5% peptone, and 1.0%, glucose) medium. Incubate the flasks at 28 °C with shaking (180 rpm) for 48 h.
   2. For the mass production of spores by SSF, use rice as a substrate unless otherwise noted.
   3. For SSF, fill autoclave bags (type/14 with a single microvented filter of 0.5 µm; 2 kg capacity; 64 × 36 cm) with 2 kg of rice. Add 1,000 mL of distilled water to the rice in the bags and soak overnight¹⁴. Autoclave the bags with the soaked rice at 121 °C for 45 min¹⁵.
   4. Inoculate the bags with 48-h-old mycelial inoculum (10% inoculum, 200 mL for 2 kg of rice) and incubate at 28 °C and 70-80% RH for 14 days.
   5. Harvest the spores by liquid extraction using 0.1% Tween-80. For this, add the contents of the bag to 0.1% Tween-80 (3 L per 1 kg of rice), mix thoroughly, separate the spores from the liquid by centrifugation, and dry at 37 °C for 2 days.
   6. Alternatively, dry the bags containing rice with the spores and some mycelia at 37 °C for 2 days to reduce the moisture content (<20%). Harvest the spores using a myco-harvester or vibro-sifter.
2. Viability studies
   1. Determine the percent viability of the harvested spores using different methods¹⁵. For this, prepare the spore suspensions in 0.1% (w/v) Tween-80 and adjust the count to 1 × 10³ spores/mL.
   2. Spread the spore suspensions (0.1 mL) onto PDA plates in triplicate and incubate at 28 °C and 70-80 % RH for 72 h.
   3. Manually count the isolated colonies and determine the total viable count for the respective sample.
3. Spore sedimentation rate
   1. For a uniform dosage, the homogenous spore suspension is required; determine the spore sedimentation rates for Metarhizium isolates as described¹⁶. Check the sedimentation rates of spores in 0.2 M ammonium sulphate and 0.1% Tween-80.
   2. Adjust the count of the spore suspension to ~7 × 10⁷ spores/mL to obtain an initial absorbance of 0.6 at 540 nm. Allow the cuvettes to stand undisturbed for 6 h for the spores to settle.
   3. Record the absorbance for up to 6 h. Express the sedimentation rate in percent and calculate the time required for 50% sedimentation (ST₅₀). Repeat the experiment thrice using freshly prepared spore suspensions.

5. Field Performance Studies of the Ability of the Selected M. anisopliae Isolate to Control H. armigera in Pigeon Peas

1. Wettable powder formulation of M. anisopliae M 34412 spores
   1. Prepare the 2.5-5% wettable powder formulation by mixing the spores with talc.
   2. Adjust the final viable count (TVC) to 1 x 10¹² spores per kg of formulation.
2. Field performance studies of M. anisopliae M 34412 spores
   1. For field performance studies of the ability of the selected M. anisopliae isolate to control H. armigera infestation in pigeon peas,use an RCBD with four replications.
      Note: Here, performed at Mahatma Phule Krushi Vidyapeeth (MPKV), Rahuri (19.3927° N, 74.6488° E).
   2. Use two different spray formulations, an oil formulation of spores (5 x 10¹² spores/3 L of diesel: sunflower oil, 7:3) and an aqueous formulation in Tween-80 (0.1%). Spray the oil formulation with an ultra-low volume (ULV) sprayer (70 min; 3 L/ha) the aqueous formulation with a knapsack sprayer (5 x 10¹² spores, 500 L/ha).
      Note: Here, the larval populations were recorded one day before the spray and 3 and 7 days after the application of each spray to 5 randomly selected plants. The total population was transformed to the square root of n + 1 for the statistical analysis.
      1. According to agricultural practices for the pigeon pea crop, perform the first spraying between 10 and 15 d after egg laying and 2 more times with a 14-day interval. Perform the spraying between 16:00 and 18:00 h IST. Monitor the wind direction and, if necessary, use cloth curtains to avoid the drift of spores to neighboring plots.
   3. For comparison, spray the chemical insecticides with a hand compression knapsack sprayer.
   4. Determine the persistence of the inoculum in the field by collecting H. armigera larvae 0, 3, 5, 7, and 14 days after spraying.
   5. Keep these larvae under observation for a period of 14 days and after death, transfer them to a plastic vial containing moist filter paper. Incubate at 25 ± 2 °C and 70 ± 10% RH to observe mycosis.
   6. Determine the persistence of the inoculum on the larval population based upon the percent mortality data of the larvae collected from the field after spraying.
   7. Evaluate the field studies on the basis of percent efficacy¹⁷, percent pod damage, and percent yield¹⁸.
      Note: Here, the data for the parameters, such as temperature, humidity, wind velocity (km/h), sunshine (h), rainfall (mm), rainy days, and evaporation (mm), were recorded during a trial at an agriculture university (Mahatma Phule Krushi Vidyapeeth, Rahuri, 19.3927° N, 74.6488° E).
3. Farmers' participatory program
   1. Select the number of farmers for the demonstration trials. Supply the pigeon pea seeds (BSMR – 736) along with fertilizer to the farmers.
      Note: In this study, 20 farmers were involved. Village: Deolali Pravara, (19.473° N 74.6° E).
   2. Use the same spray formulations and number of sprays as in step 5.2.

6. Effect on Non-target Organisms

1. Observe the effect of mycoinsecticide spray, if any, on the pigeon pea leaves.
2. Collect the soil dwelling arthropods and leaf-inhabiting insects 1 day after each treatment in the untreated plots and in the plots treated with M. anisopliae.
3. Collect the soil-dwelling arthropods with pitfall traps within 24 h after treatment and collect the leaf-inhabiting insects with a sweep net on the morning following the treatment (i.e., about 15-18 h after treatment).
4. Keep them individually in cylindrical plastic boxes with diameters of 3.5 cm and heights of 4.0 cm. Check the insects daily for infection and feed them with appropriate food.
5. Record the presence of M. anisopliae, if at all, and isolate the fungus.

7. Identification of Quality-control Parameters

1. Check the spore viability by measuring the spore germination on PDA at 28 °C.
2. Measure cuticle degrading enzyme activities, such as chitinase, chitin deacetylase, chitosanase, protease, and lipase, produced in the YPG and chitin media, as described earlier¹⁵.
3. Determine the percent mortality of H. armigera in a laboratory bioassay¹⁵.
4. Use molecular markers, such as a PCR-RFLP pattern of Chitinases (Chit 1, 2, and 4) and protease (Pr1A) genes, as virulence attributes for M. anisopliae.
   1. Extract the genomic DNA from the mycelia biomass using a DNA isolation kit¹⁵. PCR-amplify the Chit1 and Chit2 gene fragments using genomic DNA as a template, with primer pairs Chit1F/Chit1R (CTCTGCAGGCCACTCTCGGT/AGCCATCTGCTTCCTCATAT) and Chit2F/Chit2R (GACAAGCACCCGGAGCGC/GCCTTGCTTGACACATTGGTAA). For Chit4, use the primer pair Chit4F/Chit4R (ATCCGGCAGCACGGCTAC/CTTGGATC CGTCCCAGTTG).
   2. For the amplification of the Pr1A gene, use the METPR2 and METPR5 primer pair (AGGTAGGCAGCCAGACCGGC/TGCCACTATTGGCCGGCGCG).
   3. Perform the restriction digestion¹⁹ of the Chit1 gene with BsaJI, BstUI, and ScrFI; of the Chit2 gene with AluI, HpyCH4IV, and HpyCH4V, and of the Chit4 gene with BstUI, HaeIII, and MboI. For the digestion of the Pr1A gene, use RsaI, DdeI, and MspI²⁰.
   4. Observe the restriction fragment length polymorphism (RFLP) pattern on 1.5% agarose gel by electrophoresis for each gene for most virulent strains (>90% mortality); this can be used as a virulence marker for the selection of M. anisopliae.