Generation, Maintenance, and Characterization of Human Pluripotent Stem Cell-derived Intestinal and Colonic Organoids

Na Qu; Abdelkader Daoud; Braxton Jeffcoat; Jorge  O. M&#250;nera

doi:10.3791/62721

JoVE Journal > Developmental Biology

Biologie du développement

Generation, Maintenance, and Characterization of Human Pluripotent Stem Cell-derived Intestinal and Colonic Organoids

Published: July 09, 2021

doi:

10.3791/62721

Na Qu¹, Abdelkader Daoud¹, Braxton Jeffcoat¹, Jorge O. Múnera¹

¹Department of Regenerative Medicine and Cell Biology,Medical University of South Carolina

Summary

Here, detailed methods for generating, maintaining, and characterizing human pluripotent stem cell-derived small intestinal and colonic organoids are described. These methods are designed to improve reproducibility, expand scalability, and decrease the working time required for plating and passaging of organoids.

Abstract

Intestinal regional specification describes a process through which unique morphology and function are imparted to defined areas of the developing gastrointestinal (GI) tract. Regional specification in the intestine is driven by multiple developmental pathways, including the bone morphogenetic protein (BMP) pathway. Based on normal regional specification, a method to generate human colonic organoids (HCOs) from human pluripotent stem cells (hPSCs), which include human embryonic stem cells (hES) and induced pluripotent stem cells (iPSCs), was developed. A three-day induction of BMP signaling sufficiently patterns mid/hindgut tube cultures into special AT-rich sequence-binding protein 2 (SATB2)-expressing HCOs containing all of the main epithelial cell types present in human colon as well as co-developing mesenchymal cells. Omission of BMP (or addition of the BMP inhibitor NOGGIN) during this critical patterning period resulted in the formation of human intestinal organoids (HIOs). HIOs and HCOs morphologically and molecularly resemble human developing small intestine and colon, respectively. Despite the utility of HIOs and HCOs for studying human intestinal development, the generation of HIOs and HCOs is challenging. This paper presents methods for generating, maintaining, and characterizing HIOs and HCOs. In addition, the critical steps in the protocol and troubleshooting recommendations are provided.

Introduction

Studying human colon development is difficult due to restrictions on the use of human fetal tissue. Animal models have been invaluable and historically used for genetic approaches in mice to study intestinal development. However, differences between mouse and human intestinal development limit the applicability of mice as a model system. For instance, although crypt formation in the small intestine and colon of mice occurs postnatally, humans are born with fully formed crypts¹. Furthermore, the human small intestine and colon contain cell types that are not found in mice, including motilin (MLN)-expressing enteroendocrine cells in the small intestine² and mucin 5B (MUC5B)-expressing goblet cells in the colon³^,⁴. For this reason, it is important to have a cell culture system that accurately models the dynamic molecular events that define the early stages of colon development. Therefore, directing hPSCs to generate cells with colon characteristics provides a powerful model for the study of human colon development.

Protocols have been developed to facilitate the reproducible⁵, synchronous, and efficient formation of intestine-like⁶ and colon-like organoids⁷ from hPSCs. These protocols use a stepwise differentiation procedure that mimics the development of the fetal intestine and colon (Figure 1). First, definitive endoderm is generated from human pluripotent stem cells by treatment with Activin A, a Nodal mimetic. Exposure of the definitive endoderm to high levels of WNT and fibroblast growth factor (FGF) induces morphogenesis into CDX2⁺ mid/hindgut tube spheroids. Midgut/hindgut spheroids are then embedded in extracellular matrix (ECM) and patterned into either HIOs or HCOs through a transient manipulation of BMP signaling. Inhibiting BMP signaling using NOGGIN or adding growth medium alone results in the formation of HIOs, which resemble the human proximal small intestine.

By activating BMP signaling using BMP2, mid/hindgut spheroids are patterned into HCOs, which retain patterning in the epithelium and mesenchyme⁷. HCOs contain colon-enriched, MUC5B-expressing goblet cells and are competent to generate colon-specific insulin-like 5 (INSL5)-expressing enteroendocrine cells. Isolated mesenchyme from HCOs expresses homeobox A13 (HOXA13) and HOXD13, which are also expressed in human primary colon mesenchyme⁸. It is important to remember that the patterning step occurs during days 7-10 of the differentiation protocol. This three-day period is sufficient to induce colonic patterning that is maintained following extended in vitro culture.

The protocols described below are for researchers who are familiar with feeder-free hPSC culture. For researchers who are not familiar with this type of hPSC culture, a training course on hPSCs such as those offered by Stem Cell Technologies or the Pluripotent Stem Cell Facility (PSCF) at Cincinnati Children's Hospital is recommended. The quality of the starting hPSCs is critical and can affect all downstream steps. The protocol that follows would begin with hPSCs that have been grown for 4 days and are ready to split.

Protocol

1. Generation of human intestinal and colonic organoids

Preparing ECM-coated plates
1. Add 50 mL of cold DMEM medium into a 50 mL conical tube.
2. Remove an aliquot of 4x hESC-qualified ECM (see the Table of Materials) from the -80 °C freezer and thaw on ice.
  NOTE: Refer to the product's certificate of analysis to determine the volume of ESC-qualified ECM required to prepare a 4x stock.
3. If hESC-qualified ECM is not fully thawed, take 750 µL of DMEM from the 50 mL conical tube and mix it with the ECM.
4. Transfer the DMEM/hESC-qualified ECM mixture to the 50 mL conical tube with DMEM and mix well. Add 0.5 mL per well into each of 4 x 24-well cell culture plates.
5. Shake the plates to spread the ECM evenly throughout the well to ensure that the entire surface is covered. Using parafilm, seal the ECM-coated plates and leave them at room temperature in a biosafety cabinet for at least 1 h. Store ECM-coated plates at 4 °C for up to 2 weeks or until needed.
hPSCs single-cell plating
1. Place an ECM-coated 24-well plate inside a biosafety cabinet for 30 min to allow it to reach room temperature.
2. Place mTeSR1 complete medium, cell detachment solution, and advanced DMEM inside a 37 °C water bath and allow them to warm up for 30 min.
3. Verify that hPSCs are at least 85% confluent with minimal differentiation. Remove any differentiated cells if necessary.
4. Prepare the plating medium in a 50 mL conical tube as follows: 13 mL of mTeSR1 and 13 µL of 10 mM Y-27632 Rho-associated protein kinase (ROCK) inhibitor.
  NOTE: Y-27632 inhibits anoikis and increases the survival of single cells.
5. To collect cells from a 6-well plate, aspirate the medium from 3 to 4 wells and wash once with 2 mL of advanced DMEM per well.
6. Aspirate the advanced DMEM and dispense 1 mL of the cell dissociation solution into each well. Incubate the plate for 5-7 min inside a 5% CO₂, 37 °C incubator. Check under the microscope that cells are in suspension.
7. Dissociate any remaining clumps of cells by pipetting up and down 4-5 times using a 5-mL pipette.
8. Add 2 mL of advanced DMEM into each well, gently pipette up and down 4-5 times, and transfer to a 15 mL conical tube. Spin down the cells at 300 × g for 3 min at room temperature.
9. Aspirate the medium from the tube without aspirating the cell pellet and add 6 mL of the prepared medium of mTeSR1 plus ROCK inhibitor. Gently resuspend the cells by pipetting up and down 3-4 times and then transfer the suspension to the rest of the mTeSR1/ROCK inhibitor medium inside the 50 mL tube. Resuspend vigorously 4-5 times and count the cells using a hemacytometer.
10. Aspirate the ECM from the 24-well plate just before plating the cells. Resuspend the cells again by pipetting up and down 2-3 times and dispense 0.5 mL of the cell suspension in each well.
  NOTE: The optimal plating density needs to be determined by the experimenter. Here, the optimal cell number is 80,000-200,000 cells per well.
11. Gently rock the plate 3 times clockwise, 3 times counterclockwise, 3 times forward and back, and 3 times side to side to evenly disperse the cells.
12. Transfer the plate to a 37 °C, 5% CO₂ incubator and incubate for 24 h.
  NOTE: Do not disturb the plate for the first few hours to ensure proper dispersal of cells within the wells.
13. After 24 h (Figure 2A), aspirate the spent medium, add 0.5 mL per well of mTeSR1, incubate again at 37 °C, 5% CO₂ for 24 h (Figure 2B), and then proceed to the next step.
Differentiation of definitive endoderm (DE) from hPSCs
1. In a 15 mL conical tube, add 13 mL of Activin Day 1 medium (see the Table of Materials), 13 µL of 100 µg/mL Activin A, and 1.95 µL of 100 µg/mL BMP4. Warm the medium in a 37 °C water bath.
2. Aspirate the mTeSR1 medium from the 24-well plate and add 0.5 mL of Activin Day 1 medium per well. Place the plate in a 37 °C, 5% CO₂ incubator and incubate for 24 h. Check the cells after 24 h.
  NOTE: Extensive cell death should be apparent, as depicted in Figure 2C. Although the monolayer will appear sparse, colonies of cells will have expanded.
3. Prepare Activin Day 2 complete medium by adding 12.5 µL of 100 µg/mL Activin A into 12.5 mL of Activin Day 2 medium in a 15 mL conical tube. Place the tube in a 37 °C water bath.
4. Take the 24-well differentiation plate out of the CO₂ incubator and remove the spent medium. Dispense 0.5 mL of prewarmed Activin Day 2 medium per well and place the plate back inside the CO₂ incubator for 24 h.
  NOTE: Care should be taken when dispensing the medium. Do not dispense medium directly in the center of the well, as this will detach cells in the monolayer. Carefully dispense medium down the side of the well. The next day, a monolayer of cells is formed with negligible cell death. Cells should now be ~90 to 95% confluent (Figure 2D).
5. Prepare Activin Day 3 complete medium by adding 12.5 µL of 100 µg/mL Activin A into 12.5 mL of Activin Day 3 medium in a 15 mL conical tube. Place the tube in a 37 °C water bath.
6. Remove the spent medium and dispense 0.5 mL of Activin Day 3 medium per well.
  NOTE: Care should be taken when dispensing medium. Do not dispense medium directly in the center of the well as this will detach cells in the monolayer. Carefully dispense medium down the side of the well. The next day, the monolayer should reach full confluency with little to no cell death at this stage. Do not attempt to generate mid-hindgut spheroids if the monolayer is not confluent 24 h after adding Activin Day 3 medium. Refer to Figure 2E for the ideal morphology of the DE monolayer before proceeding to the generation of mid-hindgut spheroids.
7. Perform immunofluorescence (IF) staining of the monolayer for the expression of forkhead box A2 protein (FOXA2) and sex-determining region Y (SRY)-box transcription factor 17 (SOX17) when optimizing DE differentiation.
Differentiation of DE into mid-hindgut spheroids
1. In a 50 mL conical tube, add 25 mL of mid-hindgut induction medium with FGF4 (no CHIR99021) and place it in a 37 °C water bath for 30 min.
2. To prepare the complete mid-hindgut induction medium, add 7.5 µL of CHIR99021 after the medium is warm.
3. Remove the spent medium, dispense 0.5 mL of mid-hindgut induction medium per well and incubate at 37 °C, 5% CO₂ for 24 h.
4. After condensation of cells within the monolayer has occurred the next day (Figure 3A), replace the spent medium with fresh mid-hindgut induction medium and place the plate back in a 37 °C, 5% CO₂ incubator for 24 h.
  NOTE: Tubular structures will be noticeable after 48 h of mid-hindgut induction, as shown in Figure 3B. Mid-hindgut spheroids will start budding off the monolayer on day 3, as depicted in Figure 3C.
5. To avoid discarding the floating spheroids while changing the medium, transfer the old medium into a 15 mL tube and centrifuge at 300 × g for 1 min. Resuspend the spheroids in 12.5 mL of fresh mid-hindgut induction medium, add 0.5 mL per well into the same 24-well plate, and incubate at 37 °C, 5% CO₂ for 24 h.
6. On day 4 of hindgut induction (Figure 3D), harvest floating spheroids from the plate wells by collecting the medium into a 15 mL tube followed by centrifugation at 300 × g for 1 min. Proceed to the next step for embedding mid-hindgut spheroids in ECM.
Plating and patterning of mid/hindgut spheroids in ECM
1. Thaw ECM basement membrane matrix at 4 °C overnight before the embedding.
  NOTE: This ECM is different from the hESC-qualified ECM. The ECM should be put on ice, and the appropriate volume of ECM can be aliquoted into prechilled 1.5 mL microcentrifuge tubes on ice. Table 1 contains information about ECM volume. Ensure that the volume of ECM is at least 75% in the droplet in which the spheroids will be embedded.
2. Warm up a 24-well plate in a 37 °C incubator.
3. Collect the floating spheroids from all the 24-wells using a 1000 µL pipet and transfer them to a 15 mL conical tube. Spin down the spheroids at 300 × g for 1 min at room temperature. Aspirate most of the medium but leave the volume required for plating (Table 1).
4. Prepare 1000 µL and 200 µL pipette tips by cutting their ends. Take out the prewarmed 24-well plate.
5. Mix the floating spheroids, transfer the appropriate volume to the ECM tube placed on ice, and then resuspend the spheroids and ECM by pipetting to mix them well.
6. Take 65 µL of the mixture of spheroids and ECM with the cut 200 µL pipette tips and load to the center of each well in the 24-well plate. To make sure a good ECM droplet is formed, lift the pipet gently and slowly while the mixture is dispensed.
  NOTE: Plate 30-100 spheroids per well.
7. Gently transfer the plate to a 37 °C, 5% CO₂ incubator and incubate for 5 min.
8. Flip the plate upside down and incubate for 15-25 min, which will help the ECM droplets to maintain a dome-like structure.
9. During the incubation, prepare the required medium and warm it up. Once the ECM is solidified, add 0.5 mL of HIO- or HCO-patterning medium in each well and incubate at 37 °C, 5% CO₂. See Figure 3E for an image of spheroids in ECM.
10. Culture the spheroids in the patterning medium for 3 days.
11. After 3 days, change the HIO- or HCO-patterning medium to normal growth medium and incubate at 37 °C, 5% CO₂.
  NOTE: The organoids at this time point (Day 10) are early-stage organoids. Based on the project goal, some early-stage organoids can be used for early patterning analysis, as detailed in section 2.
Outgrowth and passaging of human intestinal and colonic organoids
1. After day 10, change the growth medium every 3 days.
  NOTE: Depending on the plating density and the growth of the organoids, more frequent media changes may be required. Medium changes should be done before the phenol red (pH indicator) in the medium becomes yellow.
2. Incubate the organoids until Day 21 (Figure 3F).
  NOTE: BMP2 treatment will result in a reduced number of organoids (~3-fold less than HIOs) that grow from spheroids. Therefore, a larger number of spheroids needs to be plated for the generation of HCOs.
Splitting of organoids on Day 21
1. Inspect the organoids.
  NOTE: The organoids need to be split on Day 21 as the ECM is almost degraded by Day 21 due to organoid growth and expansion.
2. Prepare the 1000 µL and 200 µL pipette tips by cutting their ends.
3. Warm up a 24-well Nunc plate in a 37 °C incubator.
4. Aliquot the appropriate volume of ECM into the prechilled 1.5 mL tubes (Table 1).
5. Gently scrape the ECM droplet with the organoids with a 1000 µL pipette tip and pipette the mixture up and down several times to break up the ECM.
6. Transfer the mixture to a 60 mm Petri dish and check the organoids under a microscope. If necessary, separate the organoids from each other using sterile forceps. Ensure that the separation does not damage the epithelium of the organoids.
7. Transfer the organoids to a 15 mL conical tube and centrifuge at 300 × g for 30 s. Aspirate the supernatant and leave ~1 mL of medium in the tube.
  NOTE: The volume of the medium can be changed based on the purpose of the experiment. If more organoids are required per ECM droplet, the medium volume can be decreased. However, if fewer organoids are required, the medium volume can be increased.
8. Mix the organoids well, transfer the appropriate volume to the ECM tube placed on ice, and then resuspend the organoids and ECM by pipetting to mix them well.
9. Add 65 µL of the mixture of spheroids and ECM to the center of each well of the 24-well plate using the cut 200 µL pipette tips.
  NOTE: It is critical to take up the organoids first and then the ECM during the pipetting. Thus, while dispensing the mixture, the organoids are at the top of the ECM droplet.
10. Put the plate in a 37 °C, 5% CO₂ incubator for 5 min.
11. Flip the plate upside down for another 15-25 min to help the ECM droplets maintain a dome-like structure.
12. Add 0.5 mL of HIO/HCO outgrowth medium in each well and incubate at 37 °C, 5% CO₂.
  NOTE: Outgrowth medium is the same for both HIOs and HCOs after patterning.
13. Change the medium every 2-3 days until Day 35 (Figure 3G).

2. Verifying the patterning of organoids by reverse-transcription quantitative polymerase chain reaction (RT-qPCR)

Before collecting RNA, prepare 1x RNA lysis buffer following the manufacturer's instructions.
Discard the spent medium and add 350 µL of lysis buffer to each well of the 24-well plate. Lyse the organoids by pipetting up and down using a 1 mL pipette. For better lysis, vortex briefly at maximum speed for 5 s.
Keep all samples at -80 °C until ready for RNA extraction. Once ready, remove the RNA samples from the -80 °C freezer and thaw them on ice for 10 min. Vortex the tubes vigorously at room temperature for 10-15 min to ensure complete lysis of the samples.
Place the samples on ice again and proceed to RNA extraction as instructed by the manufacturer. Transfer the RNA samples to a -80 °C freezer if not ready to proceed to the next step.
Perform RNA extraction, DNAse treatment, cDNA synthesis, and RT-qPCR using standard methodology. Refer to Table 2 for a list of primer names and sequences.

3. Verifying the patterning of organoids by immunofluorescence

Collection and fixation of organoids
1. Aspirate HIO or HCO medium from the appropriate wells and add 1 mL of ice-cold phosphate-buffered saline (PBS) to each well. Dissociate the organoids from the ECM using a cut 200 µL pipette tip. Pipette up and down to dissociate large chunks of ECM from the organoids.
2. Transfer the organoids to a 15 mL conical tube and fill the rest of the tube with ice-cold PBS and mix gently by inverting the tube. Allow the organoids to settle by gravity and aspirate the PBS.
  NOTE: If the organoids do not settle by gravity, centrifuge at 300 × g for 1 min.
3. Aspirate the PBS and add 1 mL of ice-cold ECM-degrading solution. Keep the tube on ice for 10-15 min on a rotating platform with gentle shaking.
  NOTE: Tilt the tube at a 45° angle to allow proper mixing of the organoids and the Cell Recovery Solution. After 10-15 min, the organoids should settle to the bottom of the tube, indicating the complete digestion of the ECM.
4. Add cold PBS in the tube up to 15 mL; mix well by inverting the tube several times. When the organoids settle to the bottom of the tube, aspirate the PBS and add 1 mL of prechilled 4% paraformaldehyde to fix the organoids. Incubate the organoids with 4% paraformaldehyde on ice for 1 h.
5. Fill the rest of the tube with ice-cold PBS and place it horizontally on a rocking platform at 4 °C overnight. The next day, dispose of the paraformaldehyde/PBS in the specified waste container and wash once with 15 mL of ice-cold PBS, as described in step 3.1.2.
6. Aspirate the PBS and fill the tube with 30% sucrose in PBS. Place the tube horizontally on a rocking platform at 4 °C overnight.
7. The next day, embed the organoids in a 7 mm x 7 mm x 5 mm base model with OCT medium and flash-freeze using a dry ice/ethanol bath.
8. Dry the blocks with laboratory wipes, wrap them in a paper towel, and keep them in a -80 °C freezer overnight. The next day, cut 5 µm sections onto microscope slides using a cryostat. Store the slides at -80 °C.
Immunofluorescence staining of the organoids
1. Process the slides from the -80 °C freezer and perform IF staining using standard protocols.
2. Apply coverslips to the slides and dry them at room temperature, protected from light for at least 2 h or overnight before imaging.
3. Image the slides using a 25x objective of a confocal microscope.

Representative Results

The successful generation of spheroids during the mid/hindgut induction stage is indicative of successful patterning. Perform IF staining for CDX2 on floating spheroids and on the monolayer to confirm that patterning is correct. Although staining at the definitive endoderm (DE) stage can indicate the effectiveness of DE induction, spheroid generation is not possible without efficient DE induction. To test the efficiency of DE induction, perform IF staining and/or RT-qPCR for FOXA2 and SOX17.

Following the patterning stage, the expression of HOX factors is the best indicator of successful patterning. HOX factors are primarily expressed in the intestinal and colonic mesenchyme⁸^,⁹. Therefore, HOX factor expression will reflect the patterning of the mesenchyme. The expression of mRNA of the anterior HOX factor HOXD3 should be highest in NOGGIN-treated HIOs, less in epithelial growth factor (EGF)-treated HIOs, and lowest in BMP-treated HCOs. Conversely, HOXA13 and HOXD13 mRNA expression should be low in HIOs and high in HCOs (Figure 4). In addition, perform RT-qPCR for MSX2, a direct target of BMP signaling at day 10. SATB2 expression can be seen in the epithelium of HCOs at day 10; however, examination of SATB2 by RT-qPCR is not a reliable indicator of patterning as HIOs contain populations of neurons¹⁰^,¹¹ that can also express SATB2¹²^,¹³. Therefore, use RT-qPCR to examine HOX factor expression to determine if patterning was successful. Perform immunofluorescence staining for SATB2, CDX2, and CDH1 to determine if HCO epithelium was properly patterned (Figure 5).

Figure 1: Schematic of the differentiation protocol for HCOs. The general timeline of HCO differentiation is shown. Although HIO differentiation is not shown, it would be the same except for the patterning stage in which NOG+EGF or EGF alone would be used from days 7-10. Abbreviations: hPSCs = human pluripotent stem cells; HCOs = human colonic organoids; HIOs = human intestinal organoids; EGF = epithelial growth factor; BMP2 = bone morphogenetic protein 2; NOG = Noggin. Please click here to view a larger version of this figure.

Figure 2: Generation of the definitive endoderm monolayer from hPSCs. Morphology of hPSCs is shown before (A, B) and after Activin A Day 1 (C) after Activin A Day 2 (D) and after Activin A Day 3 (E). Staining of DE with SOX17 (F), FOXA2 (G), and SOX17/FOXA2 merged with DAPI (H). Images were acquired using a 10x objective of an Olympus IX50 inverted microscope. Scale bars = 100 µm. Abbreviations: hPSCs = human pluripotent stem cells; DE = definitive endoderm; SOX17 = sex-determining region Y (SRY)-box transcription factor 17; FOXA2 = forkhead box A2 protein. Please click here to view a larger version of this figure.

Figure 3: Morphogenesis of mid/hindgut spheroids from the definitive endoderm. Photographs of the DE monolayer following treatment of DE with MHGI medium for 24 h (A), 48 h (B), 72 h (C), and 96 h (D).MHGI medium was changed daily. Yellow arrows point to areas of endoderm condensation. White arrows point to emerging mid-hindgut spheroids. Photographs of plated spheroids (E), Day 21 HCOs (F), and Day 35 HCOs (G). Images in A–D were acquired using a 10x objective of an Olympus IX50 inverted microscope. Scale bars = 100 µm. Images in E–F were acquired using a Leica S9D stereomicroscope using a 1x objective. Abbreviations: DE = definitive endoderm; MHGI = Mid-hindgut Induction. Please click here to view a larger version of this figure.

Figure 4: HOX gene expression in human intestinal and colonic organoids at day 21. RT-qPCR using standard methods to determine the relative expression of the anterior HOX gene HOXD3 and the posterior HOX genes HOXA13 and HOXD13. For NOG HIOs, n=3. For HCOs, n=4. Error bars depict the standard error of the mean while p values are from a two-tailed Student's t-test with equal variance. *: p < 0.05 *, **: p < 0.01,***: p < 0.001. Abbreviations: HOX = homeobox protein; NOG = noggin; HIOs = human intestinal organoids; HCOs = human colonic organoids. Please click here to view a larger version of this figure.

Figure 5: Immunofluorescence staining of human intestinal and colonic organoids. Day 35 HIOs (top panels) and HCOs (lower panels) were stained for CDX2 (green), CDH1 (white), SATB2 (red), and DAPI (blue). Images were acquired using a 25x objective on an LSM 880 confocal microscope. Scale bars = 50 µm. Abbreviations: HIOs = human intestinal organoids; HCOs = human colonic organoids; CDH1 = E-cadherin; SATB2 = special AT-rich sequence-binding protein 2; DAPI = 4′,6-diamidino-2-phenylindole. Please click here to view a larger version of this figure.

	ECM (µL)	Spheroid suspension (µL)
6-Wells	375	120
12-Wells	750	240

Table 1: Volume of ECM/spheroids required for plating.

Gene	Primers	Notes:
CPHA	Forward: CCCACCGTGTTCTTCGACATT	Housekeeping gene
	Reverse: GGACCCGTATGCTTTAGGATGA
HOXD3	Forward: CACCTCCAATGTCTGCTGAA	Anterior HOX gene
	Reverse: CAAAATTCAAGAAAACACACACA
HOXA13	Forward: GCACCTTGGTATAAGGCACG	Posterior HOX gene
	Reverse: CCTCTGGAAGTCCACTCTGC
HOXD13	Forward: CCTCTTCGGTAGACGCACAT	Posterior HOX gene
	Reverse: CAGGTGTACTGCACCAAGGA
MSX2	Forward: GGTCTTGTGTTTCCTCAGGG	Direct BMP target
	Reverse: AAATTCAGAAGATGGAGCGG

Table 2: List of primers and sequences. Abbreviations: HOX = homeobox; CPHA = cyclophilin A; MSX2 = msh homeobox 2; BMP = bone morphogenetic protein.

Discussion

The differentiation of hPSCs into HIOs and HCOs is a complex process requiring quality controls at each step. The starting hPSCs need to have minimal differentiation before initiating differentiation into DE. Optimizing the density of hPSCs plated for DE differentiation is critical for the success of the protocol. To ensure the quality of DE differentiation, perform IF for FOXA2 and SOX17 to determine the efficiency of DE differentiation. DE differentiation should result in over 80% of the treated cells staining positive for FOXA2 and SOX17. Once the optimal density is established, this same density can be used for multiple experiments with similar success. Following successful DE differentiation, mid/hindgut induction should be highly efficient. After plating in ECM, patterning of mid/hindgut spheroids with BMP2 lowers the efficiency of organoid formation from spheroids (~15%). Therefore, plate 2 to 3 times more spheroids per ECM bubble for HCO generation as compared to HIOs.

The optimal density for DE differentiation will vary from cell line to cell line. However, some cell lines are difficult to differentiate into DE with Activin A alone. If multiple experiments fail, add 5-15 ng/mL of BMP4 to the day 1 Activin A medium. The addition of BMP4 has been shown to improve DE differentiation through inhibition of the pluripotency factor SOX2¹⁴. This modification does not affect mid/hindgut induction. If spheroid generation is unsuccessful, the DE monolayer should be checked for CDX2 expression to ensure proper patterning of the DE into mid/hindgut. If the DE is CDX2⁺ but does not yield any spheroids, the monolayer can be passaged as clumps and plated in ECM¹⁵^,¹⁶^,¹⁷^,¹⁸. Clumps of mid/hindgut monolayer can self-organize, grow, mature, and differentiate similar to spheroid-derived HIOs.

Despite their cellular complexity, HIOs and HCOs lack an enteric nervous system (ENS). In addition, HIOs and HCOs are immature and lack expression of brush border enzymes, limiting their utility. The ENS is derived from vagal neural crest cells (NCCs). The hPSCs that have differentiated into vagal NCCs have been incorporated into HIOs and HCOs to establish an ENS⁵^,¹⁹. Co-culture of HIOs with T lymphocytes (Jurkat cells) induces HIO maturation in vitro resulting in the expression of brush border enzymes, mature intestinal stem cell markers, and increased expression of enteroendocrine cell-expressed hormones²⁰. Similar approaches will be needed to increase the cellular complexity of HIOs and HCOs by incorporating other immune cells such as tissue-resident macrophages.

Reprogramming of patient somatic cells into iPSCs has allowed the use HIOs and HCOs for modeling diseases such as dyskeratosis congenita²¹, familial adenomatous polyposis¹⁷^,²², and ulcerative colitis¹⁰. Furthermore, clustered regularly interspaced palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9)-mediated gene editing of hPSCs has allowed functional studies of neurogenin3²³^,²⁴, paired-like homeobox 2B¹⁹, and CDX2²⁵ proteins. Further improvements in the incorporation of cell types and the induction of maturation in HIOs and HCOs will lead to better disease models. In addition, CRISPR-Cas9-mediated gene editing of genes involved in regional patterning should provide new insights into the regional specification of the intestines. HIOs and HCOs are an exciting model for studying human fetal intestine and will continue to provide insights into human intestinal development and disease.

Divulgations

The authors have nothing to disclose.

Acknowledgements

The Múnera lab is funded by NIH/NCI 5U54CA210962-02 South Carolina Cancer Disparities Research Center (SC CADRE), NIH/NIGMS P20 GM130457-01A1 COBRE in Digestive and Liver Disease, and NIH/NIDDK 1P30 DK123704-01 MUSC Digestive Disease Research Core Center.

Materials

1% Bovine serum albumin (BSA) solution	N/A	N/A	N/A
15 mL Corning tube	Falcon	21008-918	N/A
30% Sucrose	N/A	N/A	Made in PBS.
5% Normal donkey serum	Jackson ImmunoResearch Lab	017-000-121	N/A
50 mL Corning tube	Falcon	21008-951	N/A
Accutase	Thermo Scientific	A1110501	Cell detachment solution; aliquot 5 mL of Accutase into 10 mL tubes totaling 20 tubes and store at -20 °C for up to 6 months. Place at 4 °C overnight before use.
Activin A	Cell guidance Systems	GFH6-100×10	Reconstitute the lyophilized powder at 100 µg/mL in sterile PBS containing 0.1% bovine serum albumin (BSA). Aliquot 38 µL of Activin A into prechilled microcentrifuge tubes and store at -80 °C (Tubes expire 12 months from date of receipt).
Activin Day 1 medium (RPMI 1640)	Corning	MT10041CV	Use nonessential amino acids (NEAA, Corning 11140050) and store at 4 °C. Basic day 1 medium: 500 mL of RPMI 1640 and 500 mL of NEAA. When preparing Activin Day 1 medium, add 13 mL of basic day 1 medium, 13 µl of Activin A (100 µg/mL), and 2 µl of BMP4 (100 µg/mL). The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors.
Activin Day 2 medium (RPMI 1640, 0.2% FBS vol/vol)	Hyclone	SH30070.03T	Use nonessential amino acids (Corning 11140050) and store at 4 °C. Basic day 2 medium: 500 mL of RPMI 1640, 500 mL of NEAA, and 1 mL of 0.2% serum. When preparing Activin Day 2 medium, add 12.5 mL of basic day 2 medium and 12.5 µL of Activin A (100 µg/mL). The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors.
Activin Day 3 medium (RPMI 1640, 2% FBS vol/vol)	Hyclone	SH30070.03T	Use nonessential amino acids (Corning 11140050) and store at 4 °C. Basic day 3 medium: 500 mL of RPMI 1640, 500 mL NEAA, and 10 mL of 2% serum. When preparing Activin Day 3 medium, add 12.5 mL of basic day 3 and 12.5 µL of Activin A (100 µg/mL). The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors.
Alexa Fluor 488 Donkey anti-Goat	Thermo Scientific	A11055	1:500 dilution (Secondary antibody)
Alexa Fluor 488 Donkey anti-Rabbit	Thermo Scientific	A21206	1:500 dilution (Secondary antibody)
Alexa Fluor 546 Donkey anti-Mouse	Thermo Scientific	A10036	1:500 dilution (Secondary antibody)
Alexa Fluor 647 Donkey anti-Mouse	Thermo Scientific	A31571	1:500 dilution (Secondary antibody)
Base mold	Fisher	22-363-552	N/A
Basic gut medium (advanced DMEM)	Gibco	12491015	When preparing Basic gut medium, add 500 mL of DMEM, 500 mL of N2 (Gibco 17-502-048), 500 mL of B27 (Gibco), 500 mL of L-Glutamine to get 2 mM L-Glutamine (Corning A2916801), 5 mL of 100 U/mL Penicillin-Streptomycin (Gibco 15-140-122), and 7.5 mL of 1 M HEPES to get 15 mM HEPES. The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors.
Biorad CFX96 Touch Real-Time PCR Detection System	Biorad	N/A	Other qRT-PCR systems can be used.
Cell Recovery Solution	Corning	354253	ECM-degrading solution
CHIR99021	Reprocell	4000410	Reconstitute by adding 2.15 mL of DMSO at 10 mM. Prepare 50 µL aliquots and store at -20 °C. Store powder at 4 °C, protected from light.
CTRL HIO patterning medium	N/A	N/A	Basic gut medium and 100 ng/mL EGF.
DAPI	Sigma-Aldrich	D9542	1:100 dilution (Secondary antibody)
DE monolayer	N/A	N/A	Monolayer was generated in prior steps (Section 4.4).
Dispase	Gibco	17105041	Resuspend lyophilized powder in Advanced DMEM (Gibco MT15090CV) to a 1 mg/mL final concentration. Filter the solution for sterilization by vacuuming using a Millipore filter sterilization tube. Make 10 mL aliquots (1 mg/mL) and store at -20 °C for up to 6 months. Place at 4 °C overnight before use.
EGF	Thermo Scientific	236-EG-01M	When preparing 100 ng/mL EGF reconstitute 500 µg/mL in sterile PBS. Next add 2 mL of sterile PBS to 1 mg EGF and make 500 µg/mL EGF solution. Aliquot 100 µL of EGF in 20 tubes.
Fisherbrand 6 cm Petri Dishes with Clear Lid	Fisher	FB0875713A	N/A
Fisherbrand Cell Lifter	Fisher	08-100-240	N/A
Fisherbrand Class B Clear Glass Threaded Vials with Closures Attached	Fisher	03-338B	N/A
Fisherbrand Disposable Borosilicate Glass Pasteur Pipette	Fisher	13-678-2D0	N/A
Fluoromount G Slide Mounting Medium	VWR	100241-874	N/A
Gibco advanced DMEM	Gibco	12-491-023	N/A
Goat anti-E-Cadherin	R&D systems	AF648	1:400 dilution (Primary antibody)
Goat anti-SOX17	R&D systems	AF1924	1:500 dilution (Primary antibody)
HCOs patterning medium	N/A	N/A	Basic gut medium, 100 ng/mL EGF and 100 ng/mL BMP2. When preparing BMP2, add 1 mL of sterile 4 mM HCl 0.1% BSA to BMP2 vials (100 µg). Aliquot 25 µL of BMP4 solution in 4 tubes. The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors.
Hemocytometer	Sigma-Aldrich	Z359629	N/A
Human Pluripotent Stem Cells (hPSC)	Pluripotent Stem Cell Facility	N/A	Cells seeded in a Matrigel coated 24-well plate (Thermo Scientific 73520-906).
Ice-cold 4% Paraformaldehyde solution (PFA)	N/A	N/A	N/A
Ice-cold Phosphate Buffered Saline (PBS)	N/A	N/A	The pH must be 7.4.
ImmEdge Hydrophobic Barrier Pen	Vector Laboratories	101098-065	N/A
Induced Pluripotent Stem Cells (iPSCs)	Pluripotent Stem Cell Facility (Cincinnati Children's Hospital Medical Center)	N/A	Other hESC or iPSC lines can be used, but the protocol needs to be optimized for each cell line.
Leica microtome	N/A	N/A	N/A
LSM 880			confocal microscope
Matrigel Basement Membrane Matrix	Corning	354234	N/A
Matrigel hESC-qualified Matrix	Corning	354277	Prepare 4 x Matrigel aliquots which corresponds to volumes sufficient to make enough diluted Matrigel for 4 x 6-well dishes.
Mid-hindgut induction medium (RPMI 1640)	Corning	MT10041CV	Nonessential amino acids (Corning 11140050), 2% FBS vol/vol (Hyclone SH30070.03T), 3 µM CHIR99021 and 500 ng/mL FGF4. The base medium is stable for up to 3 weeks but should be used immediately after addition of growth factors.
Mid-hindgut spheroids	N/A	N/A	N/A
MilliporeSigma Steriflip Sterile Disposable Vacuum Filter Units	MilliporeSigma	SCGP00525	N/A
Mouse anti-CDX2	BioGenex	MU392-UC	1:300 dilution (Primary antibody)
Mouse anti-FOXA2	Abnova/Novus	H00003170-M01	1:500 dilution
mTeSR1 complete growth medium	Stem Cell technologies	85870	Add 100-mL of mTeSR supplement (85870) into one 400-mL mTeSR medium (85870) and aliquot into 50-mL tubes while avoiding contamination. Store at 4°C until use.
Murray's Clear solution (Also known as BABB)	Murray's	N/A	1:2 benzyl benzoate and benzyl alcohol.
NOG HIO patterning medium	N/A	N/A	Basic gut medium, 100 ng/mL EGF and 100 ng/mL NOGGIN (Dispense 25 µg of NOGGIN in 250 µl sterile PBS with 0.1% BSA).
NucleoSpin RNA	Takara	740955.25	Other RNA isolation kits may be used.
Nunclon delta surface tissue culture dish 24-wells (Nunc)	Thermo Scientific	73521-004	N/A
Nunclon delta surface tissue culture dish 24-wells coated with Matrigel	Thermo Scientific	73521-004	N/A
Nunclon delta surface tissue culture dish 6-wells (Nunc)	Thermo Scientific	73520-906	N/A
Nunclon delta surface tissue culture dish 6-wells coated with Matrigel.	Thermo Scientific	73520-906	N/A
Outgrowth medium for HIOs, CTRL HIOs, and HCOs	N/A	N/A	Basic gut medium and 100 ng/mL EGF (Final concentration)
Phosphate Buffer Saline, 0.5% Triton X (PBS-T)	N/A	N/A	N/A
Primers	Integrated DNA Technologies, Inc. (IDT)	N/A	The primers are listed in Table 2 on the protocol.
Rabbit anti-CDX2	Cell Marque	EPR22764Y	1:100 dilution (Primary antibody)
Rabbit anti-SATB2	Cell Marque	EP281	1:100 dilution (Primary antibody)
Recombinant Human BMP-4 Protein	R&D systems	314-BP-010	Reconstitute the lyophilized powder at 100 µg/mL in sterile 4 mM HCl containing 0.1% bovine serum albumin (BSA). Add 4.17 mL HCl solution to 45.83 mL molecular water totaling to 50 mL of 1 M HCl. Then add 200 µL of 1 M HCl to 49.8 mL of molecular grade water totaling to 50 mL of 4 mM HCl. Next add 0.05 g BSA to 50 mL of 4 mM HCl and filter to make sterile. Aliquot sterile 4 mM HCl 0.1% BSA to 33 microcentrifuge tube totaling and store at -20 °C. Add 100 µl of sterile 4 mM HCl 0.1% BSA to the BMP4 vials (10 µg) to make BMP4 solution at 100 µg/mL.
Recombinant Human FGF-4 Protein	R&D systems	235-F4-01M	Reconstitute at 100 µg/mL in sterile PBS containing 0.1% bovine serum albumin. Add 0.05 g of BSA in 50 mL of PBS to make 0.1% BSA. Filter 0.22 µM BSA to sterilize the BSA. Aliquot 10 mL of 0.1% BSA in 5 tubes. Add 1 mg FGF-4 in 10 mL of sterile 0.1% BSA. Aliquot 250 µL into prechilled 40 microcentrifuge tubes and store at -80 °C.
ROCK inhibitor Y-27632	Tocris	1254	The final concentration is 10 mM (10 mmol/L). Resuspend in DMSO at 10 mM and filter sterilize. Add 3 mL of sterile PBS to each vial. Aliqout 100 µL of ROCK inhibitor in 30 tubes and store at -20 °C.
SuperScript VILO cDNA Synthesis Kit	Thermo Scientific	11-754-250	N/A
SuperFrost Plus microscope slides
Tissue Tek O.C.T Compound	VWR	25608-930	N/A

References

Montgomery, R. K., Mulberg, A. E., Grand, R. J. Development of the human gastrointestinal tract: twenty years of progress. Gastroenterology. 116 (3), 702-731 (1999).
Beumer, J., et al. High-resolution mRNA and secretome atlas of human enteroendocrine cells. Cell. 181 (6), 1291-1306 (2020).
van Klinken, B. J., et al. MUC5B is the prominent mucin in human gallbladder and is also expressed in a subset of colonic goblet cells. American Journal of Physiology. 274 (5), 871-878 (1998).
Escande, F., Porchet, N., Aubert, J. P., Buisine, M. P. The mouse Muc5b mucin gene: cDNA and genomic structures, chromosomal localization and expression. Biochemical Journal. 363, 589-598 (2002).
Lau, S. T., et al. Activation of hedgehog signaling promotes development of mouse and human enteric neural crest cells, based on single-cell transcriptome analyses. Gastroenterology. 157 (6), 1556-1571 (2019).
Spence, J. R., et al. Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nature. 470 (7332), 105-109 (2011).
Munera, J. O., et al. Differentiation of human pluripotent stem cells into colonic organoids via transient activation of BMP signaling. Cell Stem Cell. 21 (1), 51-64 (2017).
Higuchi, Y., et al. Gastrointestinal fibroblasts have specialized, diverse transcriptional phenotypes: a comprehensive gene expression analysis of human fibroblasts. PLoS One. 10 (6), 0129241 (2015).
Yahagi, N., et al. Position-specific expression of Hox genes along the gastrointestinal tract. Congenital Anomalies. 44 (1), 18-26 (2004).
Sarvestani, S. K., et al. Induced organoids derived from patients with ulcerative colitis recapitulate colitic reactivity. Nature Communications. 12 (1), 262 (2021).
Holloway, E. M., et al. Differentiation of human intestinal organoids with endogenous vascular endothelial cells. Developmental Cell. 54 (4), 516-528 (2020).
Britanova, O., et al. Satb2 is a postmitotic determinant for upper-layer neuron specification in the neocortex. Neuron. 57 (3), 378-392 (2008).
Jaitner, C., et al. Satb2 determines miRNA expression and long-term memory in the adult central nervous system. Elife. 5, 17361 (2016).
Teo, A. K., et al. Activin and BMP4 synergistically promote formation of definitive endoderm in human embryonic stem cells. Stem Cells. 30 (4), 631-642 (2012).
Fordham, R. P., et al. Transplantation of expanded fetal intestinal progenitors contributes to colon regeneration after injury. Cell Stem Cell. 13 (6), 734-744 (2013).
Tamminen, K., et al. Intestinal commitment and maturation of human pluripotent stem cells is independent of exogenous FGF4 and R-spondin1. PloS One. 10 (7), 0134551 (2015).
Crespo, M., et al. Colonic organoids derived from human induced pluripotent stem cells for modeling colorectal cancer and drug testing. Nature Medicine. 23 (7), 878-884 (2017).
Lees, E. A., et al. Using human induced pluripotent stem cell-derived intestinal organoids to study and modify epithelial cell protection against Salmonella and other pathogens. Journal of Visualized Experiments: JoVE. (147), e59478 (2019).
Workman, M. J., et al. Engineered human pluripotent-stem-cell-derived intestinal tissues with a functional enteric nervous system. Nature Medicine. 23 (1), 49-59 (2017).
Jung, K. B., et al. Interleukin-2 induces the in vitro maturation of human pluripotent stem cell-derived intestinal organoids. Nature Communications. 9 (1), 3039 (2018).
Woo, D. H., et al. Enhancing a Wnt-telomere feedback loop restores intestinal stem cell function in a human organotypic model of dyskeratosis congenita. Cell Stem Cell. 19 (3), 397-405 (2016).
Sommer, C. A., et al. Modeling APC mutagenesis and familial adenomatous polyposis using human iPS cells. PLoS One. 13 (7), 0200657 (2018).
McCauley, H. A., et al. Enteroendocrine cells couple nutrient sensing to nutrient absorption by regulating ion transport. Nature Communications. 11 (1), 4791 (2020).
Zhang, X., et al. A comprehensive structure-function study of neurogenin3 disease-causing alleles during human pancreas and intestinal organoid development. Developmental Cell. 50 (3), 367-380 (2019).
Kumar, N., et al. The lineage-specific transcription factor CDX2 navigates dynamic chromatin to control distinct stages of intestine development. Development. 146 (5), (2019).