Lentiviral Mediated Production of Transgenic Mice: A Simple and Highly Efficient Method for Direct Study of Founders

All procedures that include animal work have obtained ethical approval and have been authorized by the French Ministry of Research and Education under number APAFIS#5094-20 16032916219274 v6 and 05311.02. The ICM animal facility PHENOPARC has been accredited by the French Ministry of Agriculture under the accreditation number B75 13 19. The overall protocol requires performing each procedure within a precise time frame that is summarized in in Figure 1.

1. Animal Purchase and Preparation of Basic Compounds

1. Animal purchase
   1. Order 25 vasectomized males B6CBAF1/JRj that are 8 weeks of age (F1 generation from original crosses between ♀C57Bl/6JRj and ♂CBA/JRj).
      NOTE: Isolate males upon arrival. Vasectomized males can be re-used for at least one year.
      Change the cages every 3 weeks.
   2. Order 50 B6CBAF1/JRj females that are 10 weeks of age and keep a pool of at least 50 animals.
   3. Order 10-15 C57BL/6JRj fertile males that are 8 weeks of age.
   4. Order 30 C57BL/6JRj females that are 4 weeks of age.
2. Anesthesia and euthanasia
   1. Anesthesia is performed using a volume of 300μL ketamine/xylazine mix, injected intraperitoneally (ketamine at a dose of 150μg/g body weight, xylazine at a dose of 0.15μg/g body weight). Animals are placed under heating pad to adjust body temperature. Check reflexes by pinching the tail of the animal prior to start the procedure.
   2. Euthanasia was performed by cervical dislocation. Decapitation was included as a secondary method to confirm death of the animal. Euthanasia of embryos was performed by decapitation.
      NOTE: Upon arrival, allow animals a minimum of 1 week to habituate to the facility (no handling or mating). Importantly, any mouse strains including transgenic lines can be utilized as fertile males and fertile females for superovulation. The choice of strain should be made according to the requirements of the scientific question.
3. Hormone preparation
   1. Add 910 µL of PSMG (Pregnant Mare Serum Gonadotropin) buffer into 1 lyophilized PMSG vial, make 100 µL aliquots, and store at -20 °C.
      NOTE: Each aliquot contains 55 UI for 11 mice. Never keep PMSG aliquots for more than 2 weeks after the first use.
   2. Add 2730 µL of hCG (Human Chorionic Gonadotropin) buffer into 1 lyophilized hCG vial. Make 100 µL aliquots, and store at -20 °C.
      NOTE: Each aliquot contains 55 UI for 11 mice.
4. Hyaluronidase preparation
   1. Reconstitute 1 vial of hyaluronidase with 3 mL of M2 Medium to obtain a 10 mg/mL stock solution and make 50 µL aliquots. Then store at -20 °C.
5. Surgery tools preparation
   1. Sterilize all surgery tools using the autoclave.

2. Superovulation of Female Donors

1. In an animal facility using 12 h day -night cycles, inject PMSG at 2 PM on day -3. Inject hCG at 12 AM on day -1 and mate with fertile males just after hCG injection.
2. On day -3, add 1 mL of sterile 0.9% NaCl solution into 1 aliquot of 100 µL of PMSG (55 UI). Inject 10 C57BL/6JRj females with 100 µL intraperitoneally using a syringe without any dead volume.
   NOTE: Each mouse will receive 5 UI of PMSG.
3. On day -1, add 1 mL of sterile 0.9% NaCl solution into 1 aliquot of 100 µL of hCG (55 UI). Inject the mice that received the PMSG injection with 100 µL of diluted hCG solution (5UI) intraperitoneally. Use a syringe without any dead volume. Perform the injection slowly and wait before removing the needle so that the liquid does not leak.
   NOTE: Each mouse will receive 5 UI of hCG. Injection of hCG should be performed 46 h after PMSG.
4. Place each C57BL/6JRj female in the cage of the stud male directly after hCG injection.
5. Check vaginal plugs on the morning of day 0 and use the positive females to collect fertilized eggs.

3. Prepare the B6CBAF1/jRj Pseudopregnant Females

1. Mate one vasectomized male the day before egg collection (day -1) with 2 B6CBAF1/JRj females at 5 PM.
   NOTE: It is very important to mate with females that are originating from different cages to avoid synchronization of female cycles. This will increase the yield of obtaining vaginal plugs. In addition, do not add a female to a male cage that has been changed within the past 2 days. Efficacy of reproductive behavior in the male is increased when the cage is dirty.

4. Fertilized Eggs Collection

1. Preparation
   1. Add 1450 µL of M2 to hyaluronidase stock solution to prepare the hyaluronidase working solution.
   2. Place one drop of 100 µL of hyaluronidase working solution per female used to produce fertilized eggs in a 100 mm Petri dish and keep at room temperature.
   3. Add 500 µL of M16 into 4 wells plates. Use 2 wells per type of lentiviral vectors that will be injected: one well will contain the injected eggs and the other the non-injected ones. Place the 4 well plates in the incubator at 37 °C with a 5% CO₂ atmosphere.
2. Prepare pipettes for collection and handling of embryos.
   1. Soften the glass hematocrit capillaries (75 mm/60 µL) by rotating the center of the hard glass capillary tubing in the flame.
   2. Remove the capillaries from the heat as quickly as possible and pull to obtain a tube with an internal diameter of about 300 µm. Pull on the cooled tubing to obtain a neat break.
3. Collect oviducts.
   1. Euthanize C57BL/6JRj females by cervical dislocation at 9 AM on day 0. Death is confirmed by decapitation.
      NOTE: This euthanasia method was approved by the IACUC and follows European recommendations.
   2. Perform a large horizontal incision to open the abdominal cavity with scissors. The oviduct is located between the uterus and the ovary.
   3. Remove the mesometrium and the membrane carrying prominent blood vessels with curved forceps.
   4. Separate the oviduct from the ovary with curved forceps.
   5. Use curved forceps as a guide to cut the oviduct from the ovary using curved scissors.
   6. Pull the oviduct and cut from the uterus with curved scissors.
      Caution: Do not touch the swollen ampulla that contains the fertilized eggs. Perform the entire procedure using sterile instruments.
   7. Place all collected oviducts in M2 medium (35 mm culture dish) at room temperature
   8. Place 2 oviducts in the same 100 µL drop of hyaluronidase working solution (0.3 mg/mL).
4. Remove cumulus cells from fertilized eggs.
   1. Under a stereomicroscope, use 2 insulin syringes: the first one to hold the oviduct and the second one to tear up the ampulla and disperse fertilized eggs into the hyaluronidase working solution.
   2. Take the prepared glass pipet for collecting eggs and connect it to the tubing and a 0.22 μm filter mounted on the mouthpiece to aspirate all the eggs. Collect all eggs and wash them by successive passage into 6 different drops of 100 µL of M2 medium.
   3. Place washed fertilized eggs into humidified 37 °C incubator with an atmosphere of 5% CO₂ in M16 medium.

5. Making Injection Pipettes

1. Use thin-walled glass capillary tubing (10-15 cm long) with an outside diameter of 1 mm and clamp this capillary into horizontal micropipette puller.
   NOTE: In most horizontal pipette pullers, 3 parameters can be adjusted: heat power, pulling strength and time delay between heating and pulling. Adjust these parameters to obtain injecting pipets that resembles the one presented in Figure 2A. For users that are routinely performing DNA microinjection, use the standard settings and adjust the delay between heating and pulling to change the global shape of the pipette tip.

6. Making Holding Pipettes

1. Use an injecting pipette to prepare the holding pipette.
2. Attach an injecting pipette to a microforge. Cut the pipette with the microforge to obtain a sharp symmetrical tip of 80 to 100 µm diameter. Then polish the tip with heat on the microforge to obtain a symmetrical round shape without sharp hedges.

7. Preparation of Injection Pipette Containing the Lentiviral Vector

1. Centrifuge the lentiviral vector suspension at 160 x g for 2 min to pellet debris often present in frozen lentiviral stocks.
2. Recover the supernatant and transfer it into a new 0.5 mL tube in a class II safety cabinet.
3. Transfer 1 µL of supernatant to an injection pipette prepared as described in step 5 using a Micro-loader.
4. Set the injection pipette on the instrument holder of the right micromanipulator. Connect the holding pipet to the left micromanipulator.
   NOTE: The transduction titer of the lentiviral vector will be directly correlated with the efficacy of founder production. For high efficacy (>70%), use viral vectors with a titer in the range of 100 ng of p24 capsid protein/µL. When the titer is expressed as transduction units (TU), the titer should be above 10⁹ TU/mL. Lentiviral vector stocks must be produced by transient transfection of 293T cells with the p8.91 encapsidation plasmid, pHCMV-G, encoding the vesicular stomatitis virus (VSV) glycoprotein-G as described in supplemental methods¹⁸.

8. Micro-Injection

1. Dispense 8 µL of M2 medium in the center of a depression slide and cover with light paraffin oil (embryo tested) to avoid evaporation.
2. Place 20 eggs into the drop as least dispersed as possible.
   CAUTION: Do not make bubbles when depositing the embryos.
3. Make sure that the tip of the injection pipette is open. If not, tap the injection pipette with the holding pipette.
4. Set the microinjector for an injection time of 20 s.
   NOTE: The viscosity of the viral suspension allows clear visualization of the dispersion of the viral vector in the perivitelline space. The injection pressure should be adjusted in order to fill the entire space within 20 s of injection, which represents a volume of 10 to 100 pL. Injection pressure should not exceed 600 hPa.
5. Aspirate one fertilized egg that contains 2 pro nuclei and 2 polar bodies with the holding pipette under the stereomicroscope.
6. Inject the egg with the microinjector using settings described in 8.4, in the perivitelline space.
   CAUTION: Do not touch the plasma membrane with injection pipet.
7. Inject all fertilized eggs available in batches of 20 eggs and place the injected eggs immediately in pre-heated M16 medium into the humidified 37 °C incubator with an atmosphere of 5% CO₂.
   NOTE: Incubate the injected eggs for a minimum of 30 min after injection before embryo transfers.

9. Transferring Embryos into B6CBAF1/JRj Pseudopregnant Females

1. Check copulation plug 16 h after mating B6CBAF1/JRj females with B6CBAF1/JRj vasectomy males. Do this just before starting the egg collection.
2. Prepare implantation pipettes for the injected embryo.
   1. Make implantation pipettes for embryos as described for collecting and handling embryos (step 4.2). Select pipettes with an internal diameter of about 150 µm with a narrow part around 4-5 cm in length.
      NOTE: The tip should be flame polished, in order to reduce possible damage to the eggs or the oviduct.
      1. Fill with light paraffin oil (embryo tested) just above the pipette shoulder.
      2. Aspirate a small air bubble, then M2 medium, and finally a second air bubble.
      3. Draw up embryos one behind each other to minimize the total volume of medium that will be injected in the oviduct along with the embryos.
      4. Finish by loading a very little drop of light paraffin oil (embryo tested) of about one embryo width.
         Caution: Be gentle while handling the pipette.
3. Embryo transfer.
   1. Sterilize all instruments.
   2. Anesthetize the female using an intraperitoneal injection of 300 μL of sterile NaCl 0.9% solution containing 150 μg per g of body weight of Ketamine and 0.15 μg per g of body weight of Xylazine.
   3. Verify the depth of anesthesia by pinching the tail of the animal with forceps and inject subcutaneouly 0.1mg/kg of analgesic (Buprenorphine) prior to start the procedure.
   4. Shave 2 cm on both sides of the back along the spinal cord at the level of the last rib.
   5. Place the female mouse on a heating pad and in a sterile field. Cut a 2 cm x 2 cm window in the middle of the mouse back.
   6. Apply an antiseptic solution (10% Povidone iodide) on the skin and make a 1 cm transverse incision with scissors, then slide the skin laterally until the ovary (orange color) is visible through the body wall.
   7. Make a 5 mm incision into the body wall just above the ovary with the fine scissors under a binocular surgical microscope.
   8. Pick up the fat pad with an atraumatic bulldog clamp and pull out the ovary, the oviduct and the top of the uterus.
   9. Visualize the ampulla and make a hemisection with vannas scissors on the oviduct segment that links the ovary to the ampulla.
   10. Introduce the transfer embryo pipette and deliver eggs into the ampulla, stopping at the first air bubble in the implantation pipette.
   11. Repeat the procedure on the second oviduct.
   12. Close the skin up with wound clips.
   13. Place the animal in the recovery chamber (39 °C, 30-60 min) until fully awake.
   14. Repeat analgesic injection after 12 h and 48 h in case of signs of pain or distress.
   15. Remove wound clips 7-10 days after surgery.
   16. Check implanted females for pregnancy by following their weight curve every 3 days after implantation. A significant weight gain can be observed 10 to 12 days after implantation and will be indicative for pregnancy.
       NOTE: All embryos that will develop here will represent putative transgenic founders. The phenotype of these founders can be analyzed at any developmental stages or after birth according to the scientific question linked to the generation of these transgenic animals.

10. Genotyping Transgenic Founders

1. Prepare genotyping buffer containing 10 mM Tris-HCl, pH 8; 5 mM EDTA, pH 8.0 with 0.2% SDS (w/v), 50 mM NaCl. Sterilize the genotyping buffer through a 0.22 µm filter and store at room temperature for several months.
2. Put extraembryonic membranes (for embryos) or little piece of tail (for born animals) into 500 µL of filtered genotyping buffer and add 15 µL of proteinase K (20 mg/mL). Incubate overnight at 55 °C.
3. Centrifuge the lysate at 15,000 x g for 5 min and then use 1 µL of supernatant for the PCR reaction. Lysate can be stored at 4 °C for several months.
4. Perform the PCR amplification of a fragment of the transgene in a 20 µL reaction volume containing 1x PCR buffer, 1.5 mM MgCl₂, 200 µM of dNTPs, 0.2 µM of each PCR primers, 1 UI of Taq DNA polymerase and 1 µL of each digested sample. As a negative control, use 1 µL of H₂O. As a positive control, use DNA from the lentiviral vector plasmid containing the transgene.
5. For detection of eGFP described use:
   eGFP Forward Primer:5' GACCACATGAAGCAGCACGACTTCT 3'
   eGFP Reverse Primer: 5' TTCTGCTGGTAGTGGTCGGCGAGCT 3'
6. Perform PCR amplification in a thermocycler: 4 min at 94 °C followed by 35 cycles of 1 min at 94 °C, 1 min at 60 °C, and 2 min at 72 °C.
7. Load the PCR product on a 2% agarose gel in order to visualize a 300 bp eGFP PCR product as illustrated in Figure 2B.
   NOTE: All individuals showing a 300 bp PCR band have integrated the eGFP transgene and can be considered as transgenics.
8. Analyze transgene expression in transgenic animals. For example, perform histological and immunostaining as illustrated in Figure 3 and Figure 4 and described in supplemental methods.
   NOTE: Both transgene expression analysis and phenotype analysis should be performed using pertinent methods according to the global scientific question.

11. Quantification of Transgene Copy Number

1. Prepare DNA samples for quantitative PCR.
   1. Extract genomic DNA (gDNA) from the Proteinase K lysate obtained in step 10.3 using a commercial kit according to manufacturer instructions.
   2. Quantify gDNA by spectrophotometry at 260 nm.
   3. Dilute each gDNA sample to a 10 ng/µL final concentration.
   4. For each sample, prepare 5 serial dilutions (1:5 ) in H₂O to obtain 6 tubes at the following concentrations: 10 ng/µL, 2 ng/µL, 0.4 ng/µL, 0.08 ng/µL, 0.016 ng/µL and 0.0032 ng/µL
2. Prepare the quantitative PCR (qPCR) reaction mix.
   1. Prepare the primer mix for qPCR. For each primer couple to use for qPCR, add 10 µL of forward primer (100 µM primer stock solution), 10 µL of reverse primer (100 µM) and 80 µL of H₂O.
      NOTE: To amplify eGFP, use Forward TCCAGGAGCGCACCATCTTCTTCA and Reverse TTGATGCCGTTCTTCTGCTTGTCG primers. Cdx2 gene is used as normalizer for the qPCR (2 copies per genome). For Cdx2 normalizer use Forward GCCAGGGACTATTCAAACTACAGG and Reverse GACTTCGGTCAGTCCAGCTATCTT primers
   2. Prepare 2 qPCR mixes, one with the eGFP primer mix and one with Cdx2 primer mix. Prepare sufficient qPCR mix to amplify the 6 dilutions in duplicates of each gDNA. One qPCR reaction contains 3.8 µL of H₂O, 5 µL of fluorescent green 2x reaction mix and 0.2 µL of primer mix.
      NOTE: For each transgenic animal to test, 24 qPCR reactions will be performed. The reaction mix is provided for a 384 well qPCR machine.
   3. For each animal to test, distribute: 12 wells with 9 µL of eGFP qPCR mix and 12 wells with 9 µL of Cdx2 qPCR mix. Add 1 µL of each gDNA dilution to 2 wells containing the eGFP qPCR mix and 2 wells containing the eGFP qPCR mix.
   4. Leave 2 wells for each qPCR mix in which gDNA was replace by H₂O as negative control.
3. Place the 384 well plate in the qPCR machine and apply the following running protocol: 10 min at 95 °C then 50 cycles of 10 s at 95 °C and 1 min at 60 °C.
4. Analyze data. For each gDNA to test, plot the Ct values as a function of the Log of total gDNA amount (6 points in duplicates). Fit the curve using linear regression with the least square method and extrapolate the Ct value corresponding to the intercept with the y axis. Use the extrapolated Ct values for eGFP and the normalized Cdx2 to calculate the eGFP copy number relative to Cdx2 (2 copies) using the standard 2^ΔdCt method¹¹.