Source: Xia, P. et al., Production of Monoclonal Antibodies Targeting Aminopeptidase N in the Porcine Intestinal Mucosal Epithelium. J. Vis. Exp. (2021)
This video demonstrates a procedure for the production of recombinant antibodies against metallopeptidase. Recombinant plasmids carrying genes for the antibody, green fluorescent protein, and antibiotic resistance are transfected into epithelial cells with lipofectamine. The transfected cells are selected and cultivated to generate recombinant antibodies.
1. Preparation of porcine aminopeptidase N (APN) protein antigen
NOTE: The pET28a (+)-APN-BL21 (DE3) strain and the APN stably expressed cells pEGFP-C1-APN-IPEC-J2 were constructed in a previous study.
2. Animal immunization
3. Hybridoma technology to produce monoclonal antibodies against APN
4. Characterization of monoclonal antibodies (mAbs) against APN protein
5. Expression of rAbs against APN
Table 1. The specific primers used in this study.
Primer | Sequence (5'-3') |
VH-VL-F | CCGGGTGGGCCGGATAGACMGATGGGGCTG |
VH-VL-R | CCGGCCACATAGGCCCCACTTGACATTGATGT |
pET28a (+)-F | TCCACCAGTCATGCTAGCCATAACAACGGTCGTGATTCGA |
pET28a (+)-R | CTGGTGCCGCGCGGCAGCCAGTGGGATACCCGTATTACCC |
pIRES2-ZsGreen1-F | CGACGGTACCGCGGGCCCGGTAACAACGGTCGTGATTCGA |
pIRES2-ZsGreen1-R | GGGGGGGAGGGAGAGGGGCGGTGGGATACCCGTATTACCC |
The authors have nothing to disclose.
Complete Freund's adjuvant | Sigma-Aldrich | F5881 | Animal immunization |
DAPI | Beyotime Biotechnology | C1002 | Nuclear counterstain |
DMEM | Gibco | 11965092 | Cell culture |
DMEM-F12 | Gibco | 12634010 | Cell culture |
Dylight 549-conjugated goat anti-mouse IgG secondary antibody | Abbkine | A23310 | Indirect immunofluorescence analysis |
Enhanced Cell Counting Kit-8 | Beyotime Biotechnology | C0042 | Measurement of cell viability and vitality |
Fetal bovine serum | Gibco | 10091 | Cell culture |
Geneticin™ Selective Antibiotic | Gibco | 11811098 | Selective antibiotic |
HAT Supplement (50X) | Gibco | 21060017 | Cell selection |
HT Supplement (100X) | Gibco | 11067030 | Cell selection |
Incomplete Freund's adjuvant | Sigma-Aldrich | F5506 | Animal immunization |
Isopropyl β-d-1-thiogalactopyranoside | Sigma-Aldrich | I5502 | Protein expression |
Kanamycin | Beyotime Biotechnology | ST102 | Bactericidal antibiotic |
Leica TCS SP8 STED confocal microscope | Leica Microsystems | SP8 STED | Fluorescence imaging |
Lipofectamine® 2000 Reagent | Thermofisher | 11668019 | Transfection |
LSRFortessa™ fluorescence-activated cell sorting | BD | FACS LSRFortessa | Flow cytometry |
Microplate reader | BioTek | BOX 998 | ELISA analysis |
Micro spectrophotometer | Thermo Fisher | Nano Drop one | Nucleic acid concentration detection |
NaCl | Sinopharm Chemical Reagent | 10019308 | Culture broth |
(NH4)2SO4 | Sinopharm Chemical Reagent | 10002917 | Culture broth |
Opti-MEM | Gibco | 31985088 | Cell culture |
Polyethylene glycol 1500 | Roche Diagnostics | 10783641001 | Cell fusion |
PrimeScript™ 1st strand cDNA Synthesis Kit | Takara Bio | RR047 | qPCR |
Protein A agarose | Beyotime Biotechnology | P2006 | Antibody protein purification |
Protino® Ni+-TED 2000 Packed Columns | MACHEREY-NAGEL | 745120.5 | Protein purification |
SBA Clonotyping System-HRP | Southern Biotech | May-00 | Isotyping of mouse monoclonal antibodies |
Seamless Cloning Kit | Beyotime Biotechnology | D7010S | Construction of plasmids |
Shake flasks | Beyotime Biotechnology | E3285 | Cell culture |
Sodium carbonate-sodium bicarbonate buffer | Beyotime Biotechnology | C0221A | Cell culture |
Trans-Blot SD Semi-Dry Transfer Cell | Bio-rad | 170-3940 | Western blot |
Tryptone | Oxoid | LP0042 | Culture broth |
Ultrasonic Homogenizer | Ningbo Xinzhi Biotechnology | JY92-IIN | Sample homogenization |
Yeast extract | Oxoid | LP0021 | Culture broth |
96-well microplate | Corning | 3599 | Cell culture |