The DNAzyme-based nanomachines can be used for highly selective and sensitive detection of nucleic acids. This article describes a detailed protocol for the design of DNAzyme-based nanomachines with a 10-23 core using free software and their application in the detection of an Epstein-Barr virus fragment as an example.
DNAzyme-based nanomachines (DNM) for the detection of DNA and RNA sequences (analytes) are multifunctional structures made of oligonucleotides. Their functions include tight analyte binding, highly selective analyte recognition, fluorescent signal amplification by multiple catalytic cleavages of a fluorogenic reporter substrate, and fluorogenic substrate attraction for an increase in sensor response. Functional units are attached to a common DNA scaffold for their cooperative action. The RNA-cleaving 10-23 DNMs feature improved sensitivity in comparison with non-catalytic hybridization probes. The stability of the DNM and the increased chances of substrate recognition are provided by a double-stranded DNA fragment, a tile. DNM can differentiate two analytes with a single nucleotide difference in a folded RNA and a double-stranded DNA and detect analytes at concentrations ~1000 times lower than other protein-free hybridization probes. This article presents the concept behind the diagnostic potential of DNA-nanomachine activity and overviews DNM design, assembly, and application in nucleic acid detection assays.
One of the earliest methods for nucleic acid detection is complementary binding of selective oligonucleotides to the analyzed RNA or DNA sequences. This method employs nucleic acid fragments (probes) that can form Watson-Crick base pairs with a targeted DNA or RNA analyte1. The complex is then differentiated from the analyte and the unbound probe by a variety of techniques. Certain methods, such as Northern blotting, in situ hybridization, or qPCR, are based on the phenomenon of complementary binding2. The most common hybridization probes have two significant drawbacks: low sensitivity (they can reach micromolar to nanomolar levels) as well as low selectivity to single nucleotide variations (SNV), including point mutations. The issue requires a sophisticated approach since the solutions to these drawbacks conflict with each other3. To provide the best selectivity, the detecting oligonucleotide should be kept short enough to form unstable hybrids with mismatched analytes. Such short oligonucleotides are not able to bind targeted nucleic acids tightly and unwind their secondary structures, thus often failing to provide a detectable signal. It is especially challenging to detect CG-rich fragments in biological RNA, or double-stranded DNA (dsDNA). On the other hand, long probes are insensitive to SNV3. To break the deadlock, the concept of a binary probe has been developed4.
Binary sensors split a single detection probe into two pieces and specialize its fragments, keeping one of them long to unwind the hairpins or invade the dsDNA. The second binary probe fragment remains short to be sensitive to a mismatched base, thus providing a means for detecting SNV. The signal will be produced if the two binary sensor parts are joined together4. The full complex can be visualized via FRET5, molecular beacon probe6,7, or G-quadruplexes with peroxidase-like activity8,9,10, or else RNA-cleaving11,12,13 DNAzyme. Binary sensors with a 10-23 DNAzyme core have been amply described. They have been adapted to detect single-stranded nucleic acid fragments created synthetically11, or single-stranded amplification products14,15. Detection without amplification is also possible, for example, in the case of 16S rRNA extracted from a cell culture, since this molecule is abundant in cells12,16. Binary sensors with a 10-23 DNAzyme core can also be adapted for non-nucleic acid detection, such as for lead ions17. Nevertheless, low sensitivity is still considered to be one of the major drawbacks of binary 10-23 DNAzyme sensors, and various approaches, including cascades18 or alternative signal-enhancing methods19, have been developed to address this issue. Unfortunately, the above techniques drastically increase the cost and instability of the sensor components, and so they have not come into practice.
The experiment described in this work uses 10-23 DNAzyme-based DNA-nanosensors referred to as DNA-nanomachines (DNM)20,21. These structures include binary sensors and also (1) DNA facilitators flanking the binary probe, unwinding the structured regions and invading into double-stranded DNAs, and (2) a DNA tile that holds all the DNM parts together in close proximity and increases the chances of signal formation (Figure 1). Altogether, the 10-23 DNAzyme-based DNMs decrease the limit of detection (LOD) down to the picomolar range21; they can be used to detect 16rRNA in cell lysates22 or report the presence of viral RNA without amplification23,24. At the same time, the DNMs remain sensitive to the SNV and can even be used to genotype alleles in heterozygous organisms25. The DNM method can be used as a complementary technique to any amplification type for product visualization or identification of the product in a complex mixture with high selectivity. The DNMs, unlike conventional TaqMan and beacon probes, do not require heating of the sample and so can be used in end-point detection protocols, making the overall detection cost-effective.
This article describes the in silico development of a DNM and demonstrates procedures for assembly and functional characterization of DNM. The work was performed using a synthetic fragment of Epstein-Barr virus (EBV) corresponding to the positions 13972-14154 of the viral DNA (OR652423.1) (see Table of materials).
The design of DNA machines is straightforward but requires some experience in designing hybridization probes or functional DNA nanostructures. It is appropriate to keep the analyte fragment as short as possible to diminish the number of possible secondary structures and simplify DNM invasion to the secondary structure. The CG content should preferably be below 60% to avoid stable intramolecular structures. Successful assembly of the DNM is achieved at slow cooling rates. In some cases, DNMs can be spontaneously asse…
The authors have nothing to disclose.
The authors would like to thank Ekaterina V. Nikitina for kindly providing gDNA of EBV. Muhannad Ateiah, Maria Y. Berezovskaya, and Maria S. Rubel thank the Ministry of Education and Science of the Russian Federation (Grant No FSER-2022-0009) and the Priority 2030 program.
1.5 mL tube | Biofil | CFT011015 | |
100 bp+ DNA Ladder | Evrogen | NL002 | |
100-1000 µL pipette | Kirgen | KG-Pro1000 | |
10-100 µL pipette | Kirgen | KG-Pro100 | |
1-10 µL pipette | Kirgen | KG-Pro10 | |
20-200 µL pipette | Kirgen | KG-Pro200 | |
2-20 µL pipette | Kirgen | KG-Pro20 | |
4x Gel Loading Dye | Evrogen | PB020 | |
Acrylamide 4K | AppliChem | A1090,0500 | |
Ammonium persulfate | Carl Roth | 2809447 | |
Biorender | Biorender | https://www.biorender.com | |
Bisacrylamide | Molekula | 22797959 | |
Boric Acid | TechSnab | H-0202 | |
ChemiDoc imaging system | BioRad | 12003153 | |
Costar 96-Well Black Polystyrene Plate | Corning | COS3915 | |
DinaMelt | RNA Institute | http://www.unafold.org/Dinamelt/applications/two-state-melting-hybridization.php | |
EDTA | Amresco | Am-O105 | |
Ethidium bromide | BioLabMix | EtBr-10 | |
HEPES | Amresco | Am-O485 | |
Magnesium chloride | AppliChem | 131396 | |
Mini Protean Tetra Cell | BioRad | 1658001EDU | |
pipette 10 µL tips | Kirgen | KG1111-L | |
pipette 1000 µL tips | Kirgen | KG1636 | |
pipette 200 µL tips | Kirgen | KG1212-L | |
Pixelmator Pro | Pixelmator Team | https://www.pixelmator.com/pro/ | |
Potassium chloride | Carl Roth | 1782751 | |
PowerPac Basic Power Supply | BioRad | 1645050 | |
RNAse/DNAse free water | Invitrogen | 10977049 | |
Sealing film for PCR plates | Sovtech | P-502 | |
Sodium chloride | Vekton | HCh (0,1) | |
Spark multimode microplate reader | Tecan | Spark- 10M | |
T100 amplificator | BioRad | 10014822 | |
TEMED | Molekula | 68604730 | |
Tris(hydroxymethyl)aminomethane | Amresco | Am-O497 | |
UNAFold | RNA Institute | http://www.unafold.org/mfold/applications/dna-folding-form.php | |
Water bath | LOIP | LB-140 | |
Oligos used | |||
Analyte: | Evrogen | direct order, standard desalting purification | |
GAGCACTTGGTCAGGCACACGG ACAGGGTCAGCGGAGGACGCG TGGCACAGCAGCCCGGGGTAG GTCCCCTGGACCTGCCGCTGG CGGACTACGCCTTCGTTGC |
|||
Tile-Arm3: | Evrogen | direct order, standard desalting purification | |
CCG GGCTGCTGTGCCATTTT TTGCTGACTACTGTCACCTCT CTGCTAGTCT |
|||
Dzb-Tile: AGACTAGCAGAGAGGTGACAG TAGTCAGCTTTTTTCGCGTCCTC CGCTGACCACAACGAGAGGAA ACCTT |
Evrogen | direct order, standard desalting purification | |
Dza: TGCCCAGGGAGGCTAGCTCT GTCCGTGTGCCTGACCA |
Evrogen | direct order, standard desalting purification | |
F-sub oligonucleotide: AAGGTT(FAM)TCCTCrGrU CCCTGGGCA-BHQ1 |
DNA-Syntez | direct order, HPLC purification |
.