JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Resultados
Discussion
Divulgaciones
Acknowledgements
Materials
Referencias
Please note that all translations are automatically generated. Click here for the English version.
Bioquímica

단일 분자 확산 및 폴리머가 밀집된 지질 막에서의 조립

Published: July 19, 2022
doi:
10.3791/64243
, , , , ,
1Department of Chemical Engineering,Indian Institute of Science, 2Holonyak Micro & Nanotechnology Lab,University of Illinois, Urbana-Champaign, 3Center for BioSystems Science and Engineering,Indian Institute of Science

Summary

여기에서는 단일 분자 전반사 형광(smTIRF) 현미경을 사용하여 인공 군집 지질 막에서 단일 분자의 결합, 이동성 및 조립을 수행하고 분석하는 프로토콜이 제시됩니다.

Abstract

세포막은 생체 분자 반응 및 신호 전달을 위해 매우 밀집된 환경입니다. 그러나 지질과 단백질 상호 작용을 조사하는 대부분의 시험관 내 실험은 네이키드 이중층 막을 사용합니다. 이러한 시스템은 막-포매된 단백질 및 글리칸에 의한 군집의 복잡성이 부족하고 세포막 표면에서 발생하는 관련 부피 효과를 배제합니다. 또한, 지질 이중층이 형성되는 음전하를 띤 유리 표면은 막 횡단 생체 분자의 자유 확산을 방지합니다. 여기에서, 우리는 붐비는 지질 막에 대한 모방으로서 잘 특성화 된 중합체 – 지질 막을 제시한다. 이 프로토콜은 폴리에틸렌 글리콜(PEG) 공액 지질을 크라우더를 지지된 지질 이중층(SLB)에 통합하기 위한 일반화된 접근 방식으로 활용합니다. 먼저, 단일 분자 실험을 수행하기 위한 현미경 슬라이드 및 커버슬립의 세척 절차가 제시된다. 다음으로, PEG-SLB를 특성화하고 단일 분자 추적 및 광퇴색을 사용하여 생체 분자의 결합, 확산 및 조립의 단일 분자 실험을 수행하는 방법에 대해 논의합니다. 마지막으로, 이 프로토콜은 단일 분자 광퇴색 분석을 통해 붐비는 지질막에서 박테리아 기공 형성 독소 Cytolysin A(ClyA)의 나노기공 어셈블리를 모니터링하는 방법을 보여줍니다. 예제 데이터셋이 포함된 MATLAB 코드도 포함되어 입자 추적, 확산 거동 추출, 소단위 계수와 같은 일반적인 분석을 수행할 수 있습니다.

Introduction

세포막은 매우 밀집되어 있고 복잡한 시스템입니다1. 분자 군집은 단백질 및 지질 2,3,4와 같은 막 결합 개체의 확산에 상당한 영향을 미칠 수 있습니다. 유사하게, 수용체 이량체화 또는 막 복합체의 올리고머화와 같은 지질막에 대한 이분자 반응은 군집 5,6,7의 영향을 받습니다. 크라우더의 특성, 구성 및 농도는여러 가지 방법으로 막 결합, 확산성 및 단백질-단백질 상호작용을 제어할 수 있습니다8,9. 세포막의 막 밀집을 제어하고 임베디드 생체 분자에 미치는 영향을 해석하는 것이 어렵 기 때문에 연구자들은 대체 시험관 내 시스템10을 구축하려고 시도했습니다.

인공 군집 막에 대한 대중적인 접근법은 이중층 막을 중합체 (폴리에틸렌 글리콜, PEG와 같은)-접목 된 지질11,12로 도핑하는 것이다. 지지된 지질 이중층(SLB)에서 단백질 및 지질 역학을 시각화하는 동안 이러한 폴리머는 이중층을 기본 지지체에서 효과적으로 들어 올려 기본 음전하를 띤 기판(예: 유리)에서 막 내장 구성 요소를 추가로 보호합니다. 중합체의 크기 및 농도를 변화시킴으로써, 분자 군집의 정도뿐만 아니라 하부 고체 지지체로부터의 분리를 제어 할 수있다(13,14). 이는 막횡단 생체분자가 활성을 잃을 수 있는 폴리머 쿠션(15,16)이 없는 고체 기판 상에 지지된 지질 이중층(17,18,19)에 비해 명백히 이점이다. 더 중요한 것은 시험관 내에서 세포막의 혼잡한 환경을 요약할 수 있다는 것인데, 이는 많은 막 공정에 중요합니다.

멤브레인 상의 표면 그래프팅된 중합체는 또한 이들의 그라프팅 밀도에 따라 이들의 구성에 변화를 겪는다12. 낮은 농도에서는 막 표면 위에 버섯으로 알려진 엔트로피 코일 모양으로 남아 있습니다. 농도가 증가함에 따라, 이들은 상호작용하기 시작하고 풀리고 확장되는 경향이 있으며, 최종적으로 멤브레인(21) 상에 조밀한 브러시-형상 형성을 산출한다. 버섯에서 브러시 정권으로의 전이는 매우 이질적이며 고분자의 특성화 된 조건에서 나타나기 때문에 고분자 접목 막에 밀집하기 위해 잘 특성화 된 조건을 사용하는 것이 중요합니다. 최근 연구20과 비교하여, 우리는 막 횡단 생체 분자의 확산 수송 및 활성을 유지하는 혼잡 한 막 조성을 확인하고보고합니다.

이 프로토콜에서는 PEG화 지질 막을 생성하는 방법에 대해 논의하고 폴리머 구성의 두 가지 다른 정권(즉, 버섯과 브러시)에서 군집을 모방하는 PEG 밀도에 대한 권장 사항을 제공합니다. 이 프로토콜은 또한 이러한 밀집된 막에 내장된 분자에 대한 단일 분자 결합, 입자 추적, 광퇴색 데이터 수집 및 분석을 설명합니다. 먼저 철저한 세척 단계, 이미징 챔버 조립 및 PEG-SLB 생성에 대해 설명합니다. 둘째, 단일 분자 결합, 입자 추적 및 광퇴색 실험에 대한 세부 정보를 제공합니다. 셋째, i) 상대적 결합 친화도 추출, ii) 분자 확산 특성화, iii) 막상의 단일 분자 영화에서 단백질 어셈블리의 서브 유닛 계수에 대해 논의합니다.

이 시스템을 단일 분자 이미징으로 특성화했지만, 이 프로토콜은 지질막에 대한 생체 분자 반응에 대한 군집의 영향을 이해하는 데 관심이 있는 모든 막 생물물리학자에게 유용합니다. 전반적으로, 우리는 혼잡하고 지지된 지질 이중층을 만들기 위한 강력한 파이프라인과 함께 이에 대해 수행된 다양한 단일 분자 분석 및 해당 분석 루틴을 제시합니다.

Protocol

1. 단일 분자 실험을 위한 슬라이드 및 커버슬립 청소 이미징 챔버를 조립하기 전에 커버슬립과 슬라이드를 모두 청소하고 준비하십시오. 다이아몬드 코팅 드릴 비트(직경 0.5-1mm)가 있는 드릴링 머신을 사용하여 유리 슬라이드에 여러 쌍의 구멍을 뚫습니다. 아크릴 시트를 사용하는 경우 그림 1과 같이 레이저 커터를 사용하여 정밀한 구멍 (0.5mm)을 만듭니…

Representative Results

PEG화된 막에서 ClyA 단백질의 결합 모니터링단계 4.5 후, 결합 동역학은 시간 경과에 따라 막 표면에 결합하는 입자의 수를 플로팅하여 추정됩니다 (비디오 1). ClyA 단백질이 5mol% PEG2000 지질로 막에 결합하면 입자 밀도가 증가하고 포화 상태에 도달합니다(그림 5). 결합 된 입자 (청록색 원)에 맞는 지수 붕괴는 막 결합에 대한 시간 상수 (τb)?…

Discussion

여기에서는 막에 내장된 생체 분자에 대해 혼잡한 환경을 나타내는 지지된 지질 이중층(SLB)에 대한 단일 분자 실험을 시연합니다. 혼잡 한 환경은 배제 된 부피 효과를 생성하여 생체 분자 반응 1,2,39,40의 향상으로 이어집니다. 폴리머가 주로 이중층 외부의 부피를 차지하는 PEG- 지질 시스템의 경우,이…

Divulgaciones

The authors have nothing to disclose.

Acknowledgements

저자는 ClyA 단백질에 대한 발현 플라스미드를 공유한 Benjamin Schuler 교수를 인정합니다. 이 작업은 휴먼 프론티어 과학 프로그램(RGP0047-2020)의 지원을 받았습니다.

Materials

2.5 ml Syringes HMD Healthcare Dispo Van, 2.5 ml Tuberculin Plastic syringe
Acetone Finar Chemicals 10020LL025
Acrylic Sheet 2 mm thick
Acrylic Sheet BigiMall 2 mm, Clear
Bath Sonicator Branson CPX-1800
Calcium Chloride
Chloroform Sigma 528730  HPLC grade
Cholesterol Avanti 700100
Coplin Jar Duran Wheaton Kimble S6016 8 Slide Jar with Glass Cover
Coverslips VWR 631-1574 24 mm X 50 mm
Cy3-DNA Strand IDT GCTGCTATTGCGTCCGTTTGGTT
GGTGTGGTTGG-Cy3
Cyanine Dye (Cy3) Cytiva Life Sciences PA23001
DiI Invitrogen D3911 Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3)))
DNA Connector Strand 1 Sigma Aldrich GCTGCTATTGCGTCCGTTTAGCT
GGGGGAGTATTGCGGAGGAAGC
T
DNA Connector Strand 2 Sigma Aldrich CGGACGCAATAGCAGCTCACAG
TCGGTCACAT
DNA Tocopherol Strand Biomers Toco-CCCAATGTGACCGACTGTGA
DOPE-PEG2000 Avanti 880130 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt)
Double Sided Tape 3M LF93010LE
Drill Bits (Diamond Coated) 0.5 – 1 mm
Drilling Machine Dremel 220 Workstation
EMCCD Andor DU-897U-CS0-#BV
Fluorescence Beads Invitrogen F10720
Glass Slides Blue Star Micro Slides, PIC-1
Glass Vials Sigma 854190
Hydrogen Peroxide Lobachemie 00182 30% Solution, AR Grade
Labolene Thermo-Fischer Scientific  Detergent
Laser 532 nm Coherent Sapphire
Laser Cutter Universal Laser Systems ILS12.75
Lissamine Rhodamine DOPE Avanti 810150 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt)
Methanol Finar Chemicals 30932LL025
Microscope Olympus IX81
Phosphate Buffer Saline (PBS) 1X
Plasma Cleaner Harrick Plasma Inc PDC-002
POPC Avanti 850457 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine
Programmable Syringe Pump New Era Pump Systems NE1010 High Pressure Syringe Pump
PTFE Caps Sigma 27141
PTFE Tubing Cole-Parmer WW-06417-21 Masterflex, 0.022" ID x 0.042" OD
Sulphuric Acid SD Fine Chemicals 98%, AR Grade
TIRF Objective Olympus UPLAPO100XOHR
Vacuum Desiccator Tarsons
Vortex Mixer Tarsons
DOWNLOAD MATERIALS LIST

Referencias

  1. Löwe, M., Kalacheva, M., Boersma, A. J., Kedrov, A. The more the merrier: Effects of macromolecular crowding on the structure and dynamics of biological membranes. The FEBS Journal. 287 (23), 5039-5067 (2020).
  2. Kuznetsova, I. M., Turoverov, K. K., Uversky, V. N. What macromolecular crowding can do to a protein. International Journal of Molecular Sciences. 15 (12), 23090-23140 (2014).
  3. Horton, M. R., Höfling, F., Rädler, J. O., Franosch, T. Development of anomalous diffusion among crowding proteins. Soft Matter. 6 (12), 2648-2656 (2010).
  4. Jeon, J. H., Javanainen, M., Martinez-Seara, H., Metzler, R., Vattulainen, I. Protein crowding in lipid bilayers gives rise to non-Gaussian anomalous lateral diffusion of phospholipids and proteins. Physical Review X. 6 (2), 021006 (2016).
  5. Zhang, Y., et al. The influence of molecular reach and diffusivity on the efficacy of membrane-confined reactions. Biophysical Journal. 117 (7), 1189-1201 (2019).
  6. Loverdo, C., Bénichou, O., Moreau, M., Voituriez, R. Enhanced reaction kinetics in biological cells. Nature Physics. 4 (2), 134-137 (2008).
  7. Monine, M. I., Haugh, J. M. Reactions on cell membranes: Comparison of continuum theory and Brownian dynamics simulations. Journal of Chemical Physics. 123 (7), 074908 (2005).
  8. Berry, H. Anomalous diffusion due to hindering by mobile obstacles undergoing Brownian motion or Orstein-Ulhenbeck processes. Physical Review E. 89 (2), 22708 (2014).
  9. Saxton, M. J. Anomalous diffusion due to obstacles: A Monte Carlo study. Biophysical Journal. 66 (2), 394-401 (1994).
  10. Andersson, J., Fuller, M. A., Wood, K., Holt, S. A., Köper, I. A tethered bilayer lipid membrane that mimics microbial membranes. Physical Chemistry Chemical Physics. 20 (18), 12958-12969 (2018).
  11. Kaufmann, S., Papastavrou, G., Kumar, K., Textor, M., Reimhult, E. A detailed investigation of the formation kinetics and layer structure of poly(ethylene glycol) tether supported lipid bilayers. Soft Matter. 5 (14), 2804-2814 (2009).
  12. Marsh, D., Bartucci, R., Sportelli, L. Lipid membranes with grafted polymers: Physicochemical aspects. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1615 (1-2), 33-59 (2003).
  13. Labouta, H. I., et al. Surface-grafted polyethylene glycol conformation impacts the transport of PEG-functionalized liposomes through a tumour extracellular matrix model. RSC Advances. 8 (14), 7697-7708 (2018).
  14. Lee, H., Larson, R. G. Adsorption of plasma proteins onto PEGylated lipid bilayers: The effect of PEG size and grafting density. Biomacromolecules. 17 (5), 1757-1765 (2016).
  15. Richter, R. P., Bérat, R., Brisson, A. R. Formation of solid-supported lipid bilayers: An integrated view. Langmuir. 22 (8), 3497-3505 (2006).
  16. Andersson, J., et al. Solid-supported lipid bilayers – A versatile tool for the structural and functional characterization of membrane proteins. Methods. 180, 56-68 (2020).
  17. Duncan, A. L., et al. Protein crowding and lipid complexity influence the nanoscale dynamic organization of ion channels in cell membranes. Scientific Reports. 7 (1), 1-15 (2017).
  18. Garenne, D., Libchaber, A., Noireaux, V. Membrane molecular crowding enhances MreB polymerization to shape synthetic cells from spheres to rods. Proceedings of the National Academy of Sciences of the United States of America. 117 (4), 1902-1909 (2020).
  19. Pollock, N. L., Lee, S. C., Patel, J. H., Gulamhussein, A. A., Rothnie, A. J. Structure and function of membrane proteins encapsulated in a polymer-bound lipid bilayer. Biochimica et Biophysica Acta (BBA) – Biomembranes. 1860 (4), 809-817 (2018).
  20. Coker, H. L. E., et al. Controlling anomalous diffusion in lipid membranes. Biophysical Journal. 116 (6), 1085-1094 (2019).
  21. Rex, S., Zuckermann, M. J., Lafleur, M., Silvius, J. R. Experimental and Monte Carlo simulation studies of the thermodynamics of polyethyleneglycol chains grafted to lipid bilayers. Biophysical Journal. 75 (6), 2900-2914 (1998).
  22. Hallett, F. R., Watton, J., Krygsman, P. Vesicle sizing number distributions by dynamic light scattering. Biophysical Journal. 59 (2), 357-362 (1991).
  23. Jin, A. J., Huster, D., Gawrisch, K., Nossal, R. Light scattering characterization of extruded lipid vesicles. European Biophysics Journal. 28 (3), 187-199 (1999).
  24. Axelrod, D. Chapter 7: Total internal reflection fluorescence microscopy. Methods in Cell Biology. 89, 169-221 (2008).
  25. Fish, K. N. Total internal reflection fluorescence (TIRF) microscopy. Current Protocols in Cytometry. 50 (1), 1-13 (2009).
  26. Fiolka, R., Belyaev, Y., Ewers, H., Stemmer, A. Even illumination in total internal reflection fluorescence microscopy using laser light. Microscopy Research and Technique. 71 (1), 45-50 (2008).
  27. Roy, R., Hohng, S., Ha, T. A practical guide to single-molecule FRET. Nature Methods. 5 (6), 507-516 (2008).
  28. Jaqaman, K., et al. Robust single-particle tracking in live-cell time-lapse sequences. Nature Methods. 5 (8), 695-702 (2008).
  29. Tinevez, J. Y., et al. TrackMate: An open and extensible platform for single-particle tracking. Methods. 115, 80-90 (2017).
  30. Jarmoskaite, I., Alsadhan, I., Vaidyanathan, P. P., Herschlag, D. How to measure and evaluate binding affinities. eLife. 9, 57264 (2020).
  31. Sathyanarayana, P., et al. Cholesterol promotes Cytolysin A activity by stabilizing the intermediates during pore formation. Proceedings of the National Academy of Sciences of the United States of America. 115 (31), 7323-7330 (2018).
  32. Mueller, M., Grauschopf, U., Maier, T., Glockshuber, R., Ban, N. The structure of a cytolytic alpha-helical toxin pore reveals its assembly mechanism. Nature. 459 (7247), 726-730 (2009).
  33. Hubicka, K., Janczura, J. Time-dependent classification of protein diffusion types: A statistical detection of mean-squared-displacement exponent transitions. Physical Review E. 101 (2), 1-13 (2020).
  34. Kepten, E., Weron, A., Sikora, G., Burnecki, K., Garini, Y. Guidelines for the fitting of anomalous diffusion mean square displacement graphs from single particle tracking experiments. PLoS ONE. 10 (2), 0117722 (2015).
  35. Persson, F., Lindén, M., Unoson, C., Elf, J. Extracting intracellular diffusive states and transition rates from single-molecule tracking data. Nature Methods. 10 (3), 265-269 (2013).
  36. McGuire, H., Aurousseau, M. R. P., Bowie, D., Blunck, R. Automating single subunit counting of membrane proteins in mammalian cells. The Journal of Biological Chemistry. 287 (43), 35912-35921 (2012).
  37. Hines, K. E. Inferring subunit stoichiometry from single molecule photobleaching. The Journal of General Physiology. 141 (6), 737-746 (2013).
  38. Zhang, H., Guo, P. Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation. Methods. 67 (2), 169-176 (2014).
  39. Phillip, Y., Schreiber, G. Formation of protein complexes in crowded environments-From in vitro to in vivo. FEBS Letters. 587 (8), 1046-1052 (2013).
  40. Mittal, S., Chowhan, R. K., Singh, L. R. Macromolecular crowding: Macromolecules friend or foe. Biochimica et Biophysica Acta – General Subjects. 1850 (9), 1822-1831 (2015).
  41. Mashaghi, S., van Oijen, A. M. A versatile approach to the generation of fluid supported lipid bilayers and its applications. Biotechnology and Bioengineering. 111 (10), 2076-2081 (2014).
  42. Wong, W. C., et al. Characterization of single-protein dynamics in polymer-cushioned lipid bilayers derived from cell plasma membranes. The Journal of Physical Chemistry B. 123 (30), 6492-6504 (2019).
  43. Shashkova, S. S., Leake, M. C. Single-molecule fluorescence microscopy review: Shedding new light on old problems. Bioscience Reports. 37 (4), 20170031 (2017).
  44. Ishikawa-Ankerhold, H. C., Ankerhold, R., Drummen, G. P. C. Advanced fluorescence microscopy techniques-FRAP, FLIP, FLAP, FRET and FLIM. Molecules. 17 (4), 4047 (2012).
  45. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  46. Carter, B. C., Vershinin, M., Gross, S. P. A comparison of step-detection methods: How well can you do. Biophysical Journal. 94 (1), 306-319 (2008).
  47. Otsuka, S., Ellenberg, J. Mechanisms of nuclear pore complex assembly – Two different ways of building one molecular machine. FEBS Letters. 592 (4), 475 (2018).
  48. Tsekouras, K., Custer, T. C., Jashnsaz, H., Walter, N. G., Pressé, S. A novel method to accurately locate and count large numbers of steps by photobleaching. Molecular Biology of the Cell. 27 (22), 3601-3615 (2016).
  49. Bryan, J. S., Sgouralis, I., Pressé, S. Enumerating high numbers of fluorophores from photobleaching experiments: A Bayesian nonparametrics approach. bioRxiv. , (2020).
  50. Bryan, J. S., Sgouralis, I., Pressé, S. Diffraction-limited molecular cluster quantification with Bayesian nonparametrics. Nature Computational Science. 2 (2), 102-111 (2022).
  51. Kim, Y., et al. Efficient site-specific labeling of proteins via cysteines. Bioconjugate Chemistry. 19 (3), 786-791 (2008).

Tags

Single-molecule ImagingPolymer-crowded Lipid MembranesSupported Lipid BilayersMembrane Biomolecular ReactionsDiffusionAssemblyPOPCDOPE-PEG(2000)Small Unilamellar VesiclesSonicationMicrofluidic Imaging Chambers

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citar este artículo
Maurya, S., Rai, V. H., Upasani, A., Umrao, S., Parwana, D., Roy, R. Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes. J. Vis. Exp. (185), e64243, doi:10.3791/64243 (2022).
Descargar cita
Reimpresiones y permisos

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image