CRISPR-Cas9-Mediated Genome Editing in the Filamentous Ascomycete Huntiella omanensis

1. Design and synthesis of the sgRNA

1. To identify potential protospacer regions that will form part of the sgRNA, manually search through the gene-of-interest for 5’ NGG 3’ triplets, using the search function in whichever program is being used. Annotate these triplets as PAM sequences.
   NOTE: Various software programs are available that search for and annotate the potential PAM and protospacer sequences.
   1. Select the 20 bp upstream of each of the identified PAM sequences and annotate these sequences as potential protospacers.
2. To decide on a single protospacer, perform the following filtering steps to discard low quality sequences.
   1. To test for the specificity of the potential protospacers, combine the PAM sequence and protospacer into a single sequence and use it as a BLASTn query against the entire genome. Discard any protospacers that show similarity to any region in the genome other than the target region (Figure 1A).
   2. To ensure that the RNA molecule will fold into the correct 3D structure for binding to the Cas9 enzyme, create a combined sequence including the protospacer and the scaffold sequence specific to the Cas9 enzyme.
      1. Upload each of the combined protospacer-scaffold sequences into an RNA secondary structure prediction tool (Table of Materials).
      2. Analyze the results by comparing the minimal free energy and centroid secondary structures.
         NOTE: Ideal protospacer candidates will have identical minimal free energy and centroid secondary structures. Both secondary structures should be comprised of three stem loops, interrupted by five ring structures. The structures should also exhibit high binding probabilities (indicated in red) throughout the entire structure, except for the region representing the protospacer (Figure 1B). The actual energy values are not relevant.
   3. Choose a final candidate from those that passed the above filtering steps by selecting the candidate that is closest to the specific region being targeted.
3. To synthesize the sgRNA as a single RNA molecule, use an sgRNA synthesis kit (Table of Materials) compatible with the particular Cas9 enzyme that will be used (e.g., Cas9 from Streptococcus pyogenes).
   NOTE: The following steps may be dependent on the sgRNA synthesis kit used. In the event that a different kit is used, follow the manufacturer’s instructions. Alternatively, the sgRNA can be ordered pre-synthesized. When working with RNA, use nuclease-free reagents and disposables.
   1. If the 20 bp protospacer chosen in step 1.3 above does not harbor a G at the 5’ end, add a G to this region.
   2. Add the T7 promoter sequence to the 5’ end of the target sequence. This sequence is standard and is 5’ TTCTAATACGACTCACTATAG 3’.
   3. Add a 14 nt overlap sequence to the 3’ end of the target sequence. This sequence is kit-specific and is 5’ GTTTTAGAGCTAGA 3’ for the kit used here.
   4. Order the resulting fragment 5’ TTCTAATACGACTCACTATAG(N)₂₀ GTTTTAGAGCTAGA, with (N)₂₀ representing the selected protospacer presynthesized (Table of Materials).
   5. In accordance with the manufacturer’s protocol (Table of Materials), combine the following reagents at room temperature: 2 µL of water, 10 µL of reaction buffer, 5 µL of synthesized protospacer sequence, 1 µL of 0.1 M DTT and 2 µL of transcriptase enzyme.
   6. Incubate this solution at 37 °C for 30 min and transfer to ice.
   7. Add 30 µL of water and 2 µL of DNase I, mix and incubate at 37 °C for a further 15 min.
   8. Visualize the resulting sgRNA on a 2% agarose gel.

2. Testing the in vitro Cleavage Ability of the sgRNA

NOTE: This step is optional but is recommended.

1. Design primers that will amplify a fragment harboring the sequence of the site that the chosen sgRNA will target and amplify the region using a standard DNA polymerase.
   NOTE: If possible, design the primers in such a way that cleavage at the target site will produce two fragments of very different sizes that can easily be distinguished from one another on a standard agarose gel.
2. Assemble the combined sgRNA-Cas9 ribonucleoprotein (RNP) by incubating a solution comprised of 30 nM sgRNA as synthesized above, 30 nM Cas9 protein, 10x reaction buffer and 10 µL of water at 25 °C for 10 min.
3. Test the cleavage ability of the sgRNA by adding the PCR product of the target region into the RNP solution to a final concentration of 3 nM.
   1. Incubate the solution at 37 °C for 15 min.
   2. Add 3 µg of proteinase K and 2 µg of RNase to the solution to stop the cleavage reaction and incubate at room temperature for 10 min.
   3. Visualize the resulting DNA fragments on a 2% agarose gel. The sgRNA is suitable for in vivo experimentation if two bands of the expected size are observed on the gel.

3. Design and synthesis of the dDNA

1. Design the dDNA to be comprised of three regions- 5’ and 3’ regions with complementarity to the genomic region being targeted and a middle region harboring a selectable marker (Table of Materials, Figure 2).
   NOTE: Other specific sequences can also be added to this selectable marker. For this particular experiment, a stop codon sequence (5’ TGA 3’) was added just before the selectable marker, thereby introducing an in-frame stop codon into the gene. The dDNA can be ordered presynthesized. Alternatively, the dDNA can be amplified and assembled using a stepwise, overlap PCR approach as detailed below.
   1. Design primers to amplify approximately 800 bp of the 5’ and 3’ flanking regions. Add 20 nt of sequence that is complementary to the selectable marker’s sequence to the 5’ region’s reverse primer and 3’ region’s forward primer.
   2. Design primers that amplify the selectable marker, ensuring that the amplified product harbors the resistance gene as well as a promoter known to work in the species of interest.
2. Using a high-fidelity DNA polymerase (Table of Materials), amplify the three dDNA regions. Amplify the 5’ and 3’ regions from the gDNA of the organism being edited. Amplify the selectable marker from a relevant source.
   1. In a single reaction, combine the amplified 5’ region with the selectable marker and, using a long-range, high-fidelity DNA polymerase, amplify the entire region.
   2. In a second single reaction, combine the amplified 3’ region with the selectable marker and, using a long-range, high-fidelity DNA polymerase, amplify the entire region.
   3. Finally, combine the two preceding PCR products into a single reaction and amplify the entire dDNA sequence with a long-range, high-fidelity DNA polymerase.
   4. Visualize the DNA fragment on a 1% agarose gel. In the event that two or more fragments are produced, purify the correctly sized fragment from the gel using a gel purification kit.

4. Extraction of protoplasts

1. To produce conidia, inoculate 200 mL of fresh 2% malt extract broth (MEB) in a 500 mL flask with a 1 cm x 1 cm mycelia-covered agar block.
   NOTE: Not all fungi are able to produce conidia. In that case, mycelia can also be used. This will typically require higher concentrations of lysing enzyme further in the protocol.
   1. Incubate the liquid culture in a shaking incubator at 25 °C with shaking at 120 rpm for 24 – 48 h.
      NOTE: This incubation time and temperature has been optimized for H. omanensis. This will need to be optimized for other species.
   2. To harvest the conidia; filter the liquid culture through a layer of sterile laboratory cloth (e.g., Miracloth), transfer the conidial suspension into 50 mL centrifuge tubes and centrifuge at 3,220 x g at 4 °C for 10 min. Discard the supernatant.
   3. Resuspend the conidia in 5 mL of water and pipette 10 µL of the conidia solution onto a microscope slide and cover with a coverslip. Visualize using a compound microscope under 40x magnification to ensure only conidia have been recovered (Figure 3A).
   4. In a 500 mL flask, inoculate 200 mL of fresh 1% MEB with the total volume of resuspended conidia.
   5. Incubate the liquid culture in a shaking incubator at 25 °C with shaking at 120 rpm for up to 12 h.
      NOTE: This incubation time has been optimized for H. omanensis. This will need to be optimized for other species.
   6. To harvest the germlings, transfer the liquid culture into 50 mL centrifuge tubes and centrifuge at 3,220 x g at 4 °C for 10 min. Discard the supernatant.
   7. Resuspend the germlings in up to 10 mL of 1 M sorbitol.
   8. Pipette 10 µL of the germling solution onto a microscope slide and cover with a coverslip. Visualize using a compound microscope under 40x magnification to ensure only germlings have been recovered (Figure 3B).
      NOTE: The protocol can be paused here. Store germlings in 1 M sorbitol at -80 °C.
2. To lyse the cell walls of the young germlings and release the protoplasts, add 1 mL of the germling suspension to 9 mL of lysing enzyme at various concentrations in a sterile 50 mL flask.
   NOTE: Different enzyme concentrations and incubation times are used and can be found in Table 1. The enzymes and concentrations are also likely to vary depending on the fungus and will need to be optimized for each species.
   1. Incubate the spore-enzyme solution in a shaking incubator at 25 °C with shaking at 80 rpm for 2 to 3 h.
   2. Filter the protoplast solution through a layer of sterile laboratory cloth and collect the protoplasts by centrifugation at 1,810 x g at 4 °C for 10 min. Discard the supernatant.
      NOTE: Protoplasts are cells without cell walls and are thus very sensitive to mechanical disruption. Be sure to handle them carefully, particularly when pipetting.
   3. Carefully resuspend the protoplast pellet in 200 µL of STC buffer (Table of Materials).
   4. Pipette 10 µL of the protoplast solution onto a microscope slide and cover with a coverslip. Visualize using a compound microscope under 40x magnification to ensure only protoplasts have been recovered (Figure 3C).
   5. Using a hemocytometer, count and calculate the number of protoplasts generated in the above steps. Dilute the protoplast solution into aliquots containing approximately 5 x 10⁶ protoplasts.
      NOTE: The protocol can be paused here. Store protoplasts in STC buffer at -80 °C.

5. Protoplast and PEG-assisted transformation and transformant recovery

1. To begin the transformation, combine approximately 5 x 10⁶ protoplasts with a single volume of the RNP solution and approximately 6 µg of the dDNA fragment.
   NOTE: Protoplasts are very sensitive to mechanical disruption. Be sure to handle them carefully, particularly when pipetting.
   1. Using a pipette, slowly drip 1 mL of a freshly prepared 30% PTC solution onto the protoplast solution and incubate the solution at room temperature for 20 min.
      NOTE: This step is a sensitive and very important step. Make sure to use freshly prepared PTC solution and drop the solution over the cells as slowly and evenly as possible, creating a hydrophobic layer across the cell surface.
   2. Add 5 mL of osmotic control medium (OCM) to the protoplast solution and pipette slowly and gently to ensure the solution is thoroughly mixed.
   3. Incubate the protoplast solution in a shaking incubator at 25 °C with shaking at 80 rpm overnight.
2. To select the transformed isolates, divide the solution into 5 empty 60 mm culture plates.
   1. Add 10 mL of OCM agar supplemented with 30 µg/mL hygromycin B to each culture plate and slowly rotate each plate to mix thoroughly.
   2. Allow the first layer of agar to set before adding 10 mL of osmotic control medium agar supplemented with 40 µg/mL hygromycin B.
   3. Allow the second layer of agar to set and incubate the cultures at 25 °C until single isolates can be seen growing through both layers of agar.
3. To recover successfully transformed isolates, transfer the individual isolates capable of growth through the agar layer supplemented with 40 µg/mL hygromycin B to fresh malt extract agar (MEA) plates supplemented with 50 µg/mL hygromycin B (MEA-50).
   1. Incubate the fresh cultures at 25 °C for 5 days, checking daily for growth. Cultures capable of sustained growth on this media have successfully been transformed and can be used for further study.

6. Confirmation of the integration and stability of the dDNA

1. In order to confirm that the dDNA has been integrated into the genome at the target region, design primers that flank the predicted 5’ and 3’ insert sites (Figure 2).
   1. Perform two PCRs using these two primer sets and a high-fidelity DNA polymerase. If both PCRs yield amplicons of expected size and sequence, the dDNA was successfully integrated into the target region. Then, assess the mutant stain for stable integration of the dDNA.
2. In order to confirm that the dDNA has been stably integrated into the genome and will be maintained during vegetative growth, perform a media transfer test.
   1. Transfer a block of mycelial-covered agar from an actively growing mutant isolate on MEA-50 medium to unsupplemented MEA medium. Incubate at 25 °C for 3 days.
   2. Transfer a block of mycelia-covered agar from the isolate growing on MEA medium to MEA-50 medium. Incubate at 25 °C for 3 days.
   3. Repeat this process, transferring actively growing mycelia from supplemented to unsupplemented medium for at least four rounds.
      NOTE: If the isolate is capable of sustained growth on MEA-50 medium after many transfers, the dDNA has been stably integrated into the genome and can be maintained through vegetative growth. The mutant stain can be assessed for the presence of only a single copy of the integrated dDNA.
3. In order to confirm that the dDNA has been integrated into the genome at a single location, perform a Southern blot analysis.
   1. Digest a total of 30 µg of gDNA from each mutant strain using HindIII and EcoRI restriction enzymes in accordance with manufacturer’s protocols.
      NOTE: While the choice of restriction enzyme is up to the researcher, ensure that the restriction enzyme’s recognition site is not present in the dDNA sequence.
   2. Separate the digested gDNA on a 0.75% agarose gel and transfer the DNA onto a nylon membrane using standard procedures³².
   3. Subject the membrane to hybridization using a probe targeting the dDNA sequence.
      1. Design primers to amplify a short (300 bp) region of the dDNA.
      2. Using these primers, synthesize the probe using a PCR DIG labeling mix.
      3. Use the newly synthesized probe for membrane hybridization, treatment and visualization using standard procedures³². If only a single band is seen in each lane, the dDNA is present at only a single location in the genome. The mutant strain can now be used for further phenotypic analysis and functional characterization experiments.

7. Phenotypic analysis of the mutant strains

1. Conduct mating experiments to determine whether the disruption of the MAT gene had an effect on the sexual capabilities of the fungus being studied.
   NOTE: This step is dependent on the particular gene and species being studied. In this case, the gene being targeting is thought to be involved in sexual reproduction and thus mating tests were conducted. If the gene was thought, for example, to be involved in asexual reproduction, then something like conidial production could be measured.
   1. In order to test the heterothallic capabilities of the mutant strain, co-inoculate fresh MEA medium with a mutant strain as well as a strain of opposite mating type. In the case of H. omanensis, keep the lids of the plates closed, but not sealed and incubate at room temperature for 7 days. Visually assess for the production of sexual structures.
   2. In order to test the homothallic capabilities of the mutant strain, inoculate fresh MEA medium with a mutant strain. In the case of H. omanensis, keep the lids of the plates closed, but not sealed and incubate at room temperature for 7 days. Visually assess for the production of sexual structures.
2. Conduct growth rate experiments to determine whether the disruption of the MAT gene had an effect on the growth rate of the fungus being studied.
   1. Create mycelial-covered agar plugs from the actively growing edge of cultures of the mutant and wildtype strains by inserting the back side of a large, sterile pipette tip into the agar.
   2. Inoculate fresh MEA medium with these agar plugs. Ensure that at least three replicates per each culture type are made.
   3. After 3 days of growth at 20 °C, measure the growth on two perpendicular diameters.
   4. Compare the data from the wildtype and mutant strains.