CRISPR Guide RNA Cloning for Mammalian Systems

Note: The following protocol outlines how to perform gRNA design using online tools (steps 1.1 – 1.4), which are common to all methods of gRNA plasmid construction detailed in this manuscript. Once the desired gRNAs are identified, steps for ordering the necessary oligonucleotides are described along with several different methods for introducing the oligonucleotides into expression vectors (e.g., pSB700). Presented are 2 methods for cloning single guide-expressing vectors based on either ligation into a predigested expression vector (steps 2 – 7.3) or Golden Gate cloning (steps 8 – 8.4). Further outlined is a strategy for cloning paired guide-expressing vectors using polymerase chain reaction (PCR) followed by Golden Gate cloning (steps 11 – 16). Finally, common methods for performing an E. coli chemical transformation (steps 9 – 9.6) and an expression vector sequence validation (steps 10 to 10.2.3) are also outlined.

1. Design gRNA oligonucleotides using online tools as follows.
   1. Design gRNAs using online tools such as the sgRNA Scorer 2.0 online tool (https://crispr.med.harvard.edu/sgRNAScorerV2/)¹³ or alternatives such as the Broad sgRNA design tool (http://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design)¹⁴ and several others¹⁵.
   2. Use the gene name, symbol, or raw DNA target sequences to generate potential gRNA sequences.
      Note: A spreadsheet (.csv/.xls) file with all the potential gRNAs against the gene or the provided sequence is created. The quality of the potential gRNAs will be reported as Score if the sgRNA Scorer 2.0 online tool is being used, or as % on-target efficiency if the Broad sgRNA design tool is being used. Both measures are derived at based on the on-target cutting activity.
   3. Consider the Off-target activity in the gRNA selection when ranking the gRNAs.
      Note: Optimal guides are those with the greatest on-target efficiency and the least off-target activity. For activation (CRISPRa), gRNAs are designed to target the region from 1 – 200 bp upstream of the transcriptional start site (TSS)^4,15. For inhibition (CRISPRi), gRNAs are designed to target the region from 50 bp upstream of the TSS until 300 bp downstream of the TSS⁵. To disable a gene using Cas9 cutting, gRNAs are designed to target the first 10 – 50% of the coding sequence downstream of the initiating codon (as gRNAs targeting the 3’ end of the gene have been shown to be less effective)¹³.
   4. Ensure no internal BsmBI sites are present if oligonucleotides are being used for the Golden Gate cloning, as this will result in the annealed oligonucleotides being digested¹³.
2. Select the genomic target sequences and remove the 3’ NGG PAM (leaving only the protospacer sequence) for the single gRNA oligonucleotide sequence modification (e.g., starting sequence: CGCGTGCTCTCCCTCATCCATGG).
   Note: If using a spreadsheet, the following formula will remove 3’ NGG: =LEFT(A2,LEN(A2)-3), where A2 is the cell containing the target sequence and the PAM.
   1. Append CACCG to the 5’ end of the oligo.
      Note: Upon ligation to the pSB700 backbone, this sequence will comprise the 3’ end of the U6 promoter driving the transcription of the gRNA. The “CACC” sequence ensures that the oligo is compatible with the overhangs of the BsmBI-digested pSB700 vector. The “G” is a requirement of Polymerase III promoters and ensures the efficient initiation of the transcription of the gRNA. Use the following formula in a spreadsheet to perform this task: =CONCATENATE(“CACCG”,(B2)), where B2 is the cell containing the protospacer sequence [e.g., adding the 5’ CACCG sequence to the protospacer: CACCGCGCGTGCTCTCCCTCATCCA (this is the final forward oligo that is ordered)].
   2. Create a reverse complement (rc) of the protospacer sequence.
      Note: For example, the reverse complement of the aforementioned protospacer is TGGATGAGGGAGAGCACGCG.
   3. Append AAAC to the 5’ end of the rc protospacer. Append an additional C to the 3’ end of the rc protospacer (reverse oligo).
      Note: The “AAAC” sequence ensures that the oligo is compatible for cloning into the BsmBI-digested pSB700 vector. The additional “C” on the 3’ end is needed to anneal the sequence to the initiating “G” added to the forward oligo. Use the following formula in a spreadsheet to perform this task =CONCATENATE(“AAAC”,(C2),”C”), where C2 is the cell containing the reverse complement sequence [e.g., AAACTGGATGAGGGAGAGCACGCGC (this is the final reverse oligo that is ordered)].
3. Order the oligonucleotides, with no additional modifications on the oligonucleotides.
   1. Order the minimal amount of oligo required, as only very small amounts are needed for the cloning reactions.
4. Dilute lyophilized primers to a final concentration of 100 μM in 1x TE buffer (10 mM Tris-Cl, pH 7.5 with 1 mM EDTA).
5. Aliquot 1:1 forward and reverse oligonucleotides (e.g., 10 μL each) into PCR strip-cap tubes.
   Note: This will allow the rapid cloning of many gRNAs at a time using a multichannel pipette.
   1. Vortex and spin down the oligo mixtures (100 x g for 15 s). Incubate the reaction at room temperature for 5 min before setting up the ligation.
      Note: It is not necessary to heat and then cool the oligo mixtures to facilitate their annealing. It is worth noting that 3 – 4 pairs of gRNA oligonucleotides may be pooled and annealed in a single reaction (e.g., mix 3 μL of forward and 3 μL of reverse oligonucleotides together from up to 4 gRNA oligo pairs, giving a total volume of 24 μL). The volume of the oligonucleotides used for the annealing may be adjusted to accommodate a user’s needs.
      Note: Steps 6 – 7.3 describe the predigestion of pSB700. For an alternative method, see step 8, which describes a single-step BsmBI restriction ligation.
6. Digest 1 – 5 μg of the selected pSB700 guide expression vector with BsmBI (0.5 μL per 1 μg) for 1 h at 55 °C¹⁵. Conduct the digestion of the pSB700 gRNA expression vector in a total volume of 40 μL (Table 1).
   1. Run the digestion products on 1.5% (wt/vol) low-melting agarose gel.
   2. Cut out the digested vector backbone band which corresponds to a fragment of ~9 kb in size and place the gel slice in a 1.5 mL microcentrifuge tube (Figure 1).
   3. Use a commercial gel purification kit to extract the DNA from the agarose gel according to the manufacturer’s instructions.
   4. Elute the DNA into 10 – 15 μL of TE buffer (10 mM Tris, pH 7.5; 10 mM Tris, pH 8.0) to obtain a concentrated eluate.
7. Ligate the annealed gRNA oligonucleotides from step 4 into the BsmBI-digested pSB700 guide expression vector in a 20 μL reaction (Table 2) for the cloning of the gRNA oligonucleotides into the pre-digested pSB700 expression vector.
   1. First, add water, buffer, and DNA, then vortex the mixture and add enzyme, vortex 1 final time after adding the enzyme and spin down the solution (100 x g for 15 s). Incubate the reactions at room temperature overnight.
   2. Include a no-insert negative control reaction that has a BsmBI-digested vector alone, without an annealed gRNA oligo insert. 1 μL of water may be used in place of the 1 μL of gRNA oligonucleotides for the no-insert negative control.
   3. Proceed to the transformation (step 9).
      Note: Step 8 is an alternative method to the predigestion of pSB700 as described in steps 6 – 7.3.
8. Introduce gRNA oligonucleotides (outlined in steps 1 – 5.1) into the pSB700 vector through the use of Golden Gate cloning for the single-step BsmBI restriction ligation.
   1. Assemble the master mix (1x)—if multiple gRNAs are being cloned, prepare the master mix without the insert oligonucleotides added (Table 3). Aliquot the master mix into PCR tubes and use a multichannel pipette to add the gRNA oligonucleotides from step 4.2. Include a no-insert control using 1 μL of water.
   2. By including the BsmBI enzyme and T4 DNA ligase within the same reaction, simultaneous restriction digestion and ligation are achieved (i.e., Golden Gate cloning). Use the following Simple Gate protocol to digest the vector and ligate the inserts in 1 reaction: keep the reaction at 37 °C for 2 h, at 50 °C for 10 min, at 65 °C for 15 min, at 80 °C for 15 min, and finally, hold it at 4 °C.
      1. Of note, verify that the oligonucleotides do not contain BsmBI sites before using this method. If the gRNAs that are being cloned contain BsmBI restriction sites, they will be digested upon the addition of BsmBI. This will prevent the user from obtaining any transformants.
   3. After the initial Simple Gate reaction, add an additional 0.5 μL of BsmBI enzyme to each reaction and place them back at 55 °C for 1 h. After the digestion, hold the reaction at 4 °C or freeze it until ready to transform. This second round of restriction enzyme incubation removes any undigested or religated wild-type pSB700 vector backbone from the reaction mixture so that only vectors that have received the oligo inserts remain intact and will yield transformants.
   4. Proceed to the transformation (step 9).
9. Transform 0.5 μL of the reaction mixture into 8 μL of competent E. coli [e.g., NEB DH5a (1 – 3 x 10⁹ cfu/µg of pUC19 DNA) or NEB Stable 1 – 3 x 10⁹ cfu/µg of pUC19 DNA). For lentiviral plasmids, NEB Stable cells will provide more consistent plasmid yields.
   1. Remove E. coli from storage at -80 °C and thaw it on ice for 5 – 10 min.
   2. Add 0.5 μL of the reaction mix to 8 μL of competent E. coli and keep the mixture on ice for 30 min.
   3. Heat shock the mixture at 42 °C for 45 s.
   4. Rest it on ice for 2 min.
   5. Recover the culture on a rotary shaker in 250 μL of SOC media for 1 h at 37 °C for NEB DH5a and at 30 °C for NEB Stables.
   6. Plate 80 μL of the culture on an appropriate antibiotic resistance Lysogeny Broth (LB) plate and incubate it overnight at 37 °C for NEB DH5a and at 30 °C for NEB Stables [e.g., pSB700 is plated on LB with ampicillin (100 μg/mL) plates] (Figure 3).
10. Validate the sequence of gRNA expression plasmid: verify the sequence of each colony by Sanger sequencing using the primer 5’-GAGGGCCTATTTCCCATGATTCC-3’ which primes at the U6 promoter upstream of the gRNA oligo insert.
    1. Pick 2 – 3 colonies per reaction for sequencing (Table 4).
       Note: Several sequencing providers now offer services that can perform Sanger sequencing directly from bacterial colonies, which greatly reduces the time and costs by eliminating the need to purify the plasmids prior to sequencing. Alternatively, a plasmid isolation kit may be used to recover the plasmid DNA from the individual bacterial clones. Purified plasmids may then be submitted for sequencing. If a pooled ligation reaction is performed, use Table 4 as a guide for the number of colonies that should be selected and submitted for sequencing.
    2. Following the sequence confirmation, isolate the gRNA expression plasmids.
       1. Use a sterile pipette tip to inoculate the desired colony into a 5 mL culture of LB medium containing 100 μg/mL of ampicillin for pSB700 expression vectors.
       2. Grow the cells in a rotary incubator at 100 rpm at 37 °C overnight (30 °C if NEB Stables are being used).
       3. Isolate the plasmid DNA from the cultures using a plasmid prep kit, following the manufacturer’s protocol.
          Note: While the above methods enable users to create single gRNA-containing vectors, this protocol will allow users to create vectors that contain 2 gRNAs, each driven by their own RNA polymerase III promoter.
11. For a paired gRNA design, use the output file from the sgRNA design tools outlined above (steps 1.1 – 1.4) and select 2 guides of interest.
    1. For an activation or repression, select pairs of guides that are at least 30 nt apart.
    2. For gRNAs used for cutting, select guides that target 2 different exons within the gene.
12. For the instructions below, designate the first gRNA in the array gRNA-A and the second gRNA in the array gRNA-B, to create a paired gRNA oligonucleotide sequence modification.
    Note: The oligo used to create gRNA-A will be called fA, and the reverse oligo used to introduce gRNA-B will be referred to as rB. The cloning method below automatically appends an initiating G at the 5’ end of each of the gRNAs.
    1. Create the appropriate fA oligo as follows.
       Note: The 20 nucleotides comprising the gRNA targeting sequence for gRNA-A will constitute the initial fA sequence upon which the following steps will build (e.g., protospacer – aggggctacaccactcattg).
       1. Append TTTTCGTCTCTCACCG to the 5’ end of fA (e.g., of the sequence TTTTCGTCTCTCACCGaggggctacaccactcattg).
       2. Append GTTTTAGAGCTATGCTGAAAAGCA to the 3’ end of fA (e.g., of the sequence TTTTCGTCTCTCACCGaggggctacaccactcattgGTTTTAGAGCTATGCTGAAAAGCA). This is the final version of the fA oligo that will be ordered.
    2. Create the necessary rB oligo as follows.
       Note: The 20 nucleotides comprising the gRNA targeting sequence for gRNA-B will constitute the initial rB sequence upon which the following steps will build (e.g., of the starting sequence gtcccctccaccccacagtg).
       1. Take the reverse complement of rB =(revcom)rB (e.g., cactgtggggtggaggggac).
       2. Append TTTTCGTCTCTAAAC to the 5’ end of (revcom)rB (e.g., TTTTCGTCTCTAAACcactgtggggtggaggggac).
       3. Append CGGTGACCCAGGCGGCGCACAAG to the 3’ end of (revcom)rB (e.g., TTTTCGTCTCTAAACcactgtggggtggaggggacCGGTGACCCAGGCGGCGCACAAG). This is the final version of the rB oligo that will be ordered.
          Note: The following formulas may be used with common spreadsheet software to automatically edit the oligo sequences: =CONCATENATE("TTTTCGTCTCTCACCG",(A2)," GTTTTAGAGCTATGCTGAAAAGCA"), where A2 is the cell containing the fA sequence, and =CONCATENATE("TTTTCGTCTCTAAAC",(B2)," CGGTGACCCAGGCGGCGCACAAG"), where B2 is the cell containing the (revcom)rB sequence.
13. Order the oligonucleotides from a synthesis vendor of choice. No additional modifications are required.
14. Use the prepared plasmid DNA to perform PCR with both fA and rB primers. This will attach both the forward and the reverse gRNAs to the pSN007 PCR fragment generated from this plasmid and will allow each to be expressed from its own promoter (U6 and 7SK promoters—different promoters are used in this design to prevent viral recombination).
    1. Use the Phusion GC Special PCR Protocol to create the needed fragment: keep the mixture at 98 °C for 1 min (1 cycle), at 98 °C for 15 s, at 53 °C for 15 s, at 65 °C for 2 min, and at 72 °C for 4 min (30 cycles), and then hold it at 4 °C (Table 5).
    2. Run the PCR product on a 1% agarose gel and verify that 1 band is seen at ~490 bp (Figure 2).
    3. Cut and extract this PCR product using a gel extraction kit of choice. Elute the DNA into 15 μL of TE buffer (10 mM Tris, pH 7.5; 10 mM Tris, pH 8.0) or distilled water.
    4. Measure the concentration of the extracted product along with that of the pSB700 vector with a spectrophotometer for the DNA molarity calculation. Normalize both the PCR product and the vector to a concentration of 40 femtomoles/μL.
       Note: Several websites are available to assist with the calculation of the molarity of a given DNA solution based on the length of the DNA and its concentration in solution (e.g., Promega: http://www.promega.com/a/apps/biomath/index.html?calc=ugpmols). The calculator uses the formula:
       
       Here, N is the length of the nucleotide sequence.
15. Set up a simultaneous restriction digestion and ligation reaction using the protocol outlined in steps 8 – 8.4 to clone the pSN007 PCR fragment into a pSB700 vector.
    1. Instead of adding 1 μL of primer solution to the reaction, add 1 μL of 40 fmole/μL of the PCR product. In addition, use 1 μL of the pSB700 vector at a concentration of 40 fmole/μL.
       Note: Equal molar ratios lead to consistent outcomes, although even in cases where exact ratios are not used, colonies can be obtained.
16. Upon completing the Golden Gate reaction process (steps 8 – 8.4), proceed to the transformation and sequence verification (steps 9 – 10.2.3).