Summary

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Published: October 23, 2017
doi:

Summary

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Abstract

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Introduction

Gene function analysis typically involves a phenotypic comparison between a wild-type strain and a strain in which a particular gene of interest has been disrupted. This gene-disruption technique has been utilized for gene function analyses in a wide range of taxa, from bacteria to mammals. A gene-disruption construct is necessary for the generation of the gene-disrupted strain; this deoxyribonucleic acid (DNA) construct consists of the antibiotic resistance marker gene fused to the upstream and downstream flanking regions of the target gene, and is incorporated into the genome via homologous recombination. The gene-disrupted strain may be isolated using selective media containing the antibiotic. The conventional method used for the construction of the gene-disrupted strain requires complex steps, such as the amplification of the target gene by polymerase chain reaction (PCR), ligation of the gene into a suitable plasmid, digestion with restriction enzymes, and religation to insert the antibiotic-resistance marker gene. This process is time-consuming, taking several days to several weeks, depending on the success of each step. In addition, the design of disruption constructs is dependent on the restriction enzyme sites of the target gene. To resolve these issues, PCR-based DNA splicing methods1,2 for the design of gene-disrupted mutants of Dictyostelium discoideum3 and Synechocystis sp. PCC68034 have been reported. In the present study, a method was developed to generate a gene-disrupted streptococcal strain in a relatively rapid, facile, and inexpensive manner, utilizing a modified PCR-based method (designated 2-step fusion PCR) for the construction of the disruption construct and electroporation for genetic transformation.

The 2-step fusion PCR requires genomic DNA, the antibiotic resistance marker gene as a PCR template, and four pairs of appropriately designed oligonucleotide primers. In the first step (1st PCR), a 1-kb upstream flanking region of the target gene, a 1-kb downstream flanking region of the target gene, and the antibiotic-resistance marker gene are amplified by PCR. The 5' regions of both the reverse primer and the forward primer, for amplification of the upstream and downstream flanking regions, respectively, include 15 bases complementary to the ends of the marker gene. The 5' regions of both forward and reverse primers for marker gene amplification similarly include 15 bases complementary to the lower end of the upstream flanking region of the target gene and the upper end of the downstream flanking region of the target gene, respectively. Therefore, the three amplified fragments contain overlapping 30-base pair regions at the fusion site. In the second step (2nd PCR), PCR is performed with nested PCR primers using the three fragments amplified by the 1st PCR as templates. The complementary regions of the templates are additionally linked to each other via the 2nd PCR. Finally, the construct for homologous recombination is introduced to the wild-type strain by electroporation. Successful gene disruption may be verified by PCR using specific primers. Although the disruption construct is amplified using high-fidelity DNA polymerase, additional enzymatic reactions, such as DNA ligation or DNA digestion, are not necessary to generate the construct. In addition, a deleted or preserved region on the genome may be flexibly chosen according to primer design.

In the present work, deletion of the entire coding region of the gtfC gene, which encodes glucosyltransferase in Streptococcus mutans, was performed to demonstrate the rapid, easy gene disruption method in a streptococcal species. Additionally, a gtfB-disrupted strain was generated in the same manner. The glucosyltransferases encoded by both gtfC and gtfB contribute to cariogenic dental biofilm development5,6. The biofilm-forming abilities of the wild-type strain (S. mutans WT), gtfC-disrupted strain (S. mutans ΔgtfC), and gtfB-disrupted strain (S. mutans ΔgtfB) were evaluated for comparative phenotypic analyses. This protocol extends the application of a two-step method for gene disruption to an additional species and may be modified for studies of gene function in a wider range of taxa.

Protocol

1. Primer Design

  1. Prepare primers for 2-step fusion PCR and verification of gene disruption.
    NOTE: Table 1 shows the primer sequences used in this protocol. Figure 1 shows a schematic illustration of the 2-step fusion PCR method used to generate S. mutans ΔgtfC.
    1. Design primers for the replacement of the target region in the genome with the spectinomycin-resistance gene (spcr)7. This protocol replaces the entire coding region of the gtfC gene with spcr.
    2. Include 15 bases complementary to the upper and lower ends of spcr at the 5' regions of up-reverse and down-forward primers, respectively. Similarly, include 15 bases complementary to the lower end of the upstream flanking regions of gtfC and the upper end of the downstream flanking regions of gtfC at the 5' regions of spcr-forward and spcr-reverse primers, respectively (Figure 1A).
      NOTE: Sequences of up-reverse, down-forward, spcr-forward, and spcr-reverse primers are automatically determined depending on the site of incorporation of the disruption construct.
    3. Design the up-forward and down-reverse primers to comprise >1-kb upstream and downstream flanking regions of the gtfC gene, respectively. Set the melting temperature (Tm) of up-forward and down-reverse primers in accordance with the melting temperature of up-reverse and down-forward primers, respectively (Figure 1A).
      NOTE: Refer to the following formula to determine Tm: Tm (°C) = 2(*NA + *NT) + 4(*NC + *NG) – 5, where *N represents the number of primer nucleotides with the specified identity (A, T, C, or G).
    4. Design nested primers (N_up-forward and N_up-reverse) for the 2nd PCR (Figure 1B).
      NOTE: Although the outermost primer pair (up-forward and down-reverse) may be used as primers for the 2nd PCR, nested primers (N_up-forward and N_up-reverse) were designed in this protocol. Nested primers are frequently required for the 2nd PCR, as detailed in the Representative Results.
    5. Design primers specific for spcr. The primers are used for colony PCR to screen for gtfC disruption.
    6. Design primers for the verification of gtfC disruption.
      NOTE: The PCR products amplified using these primers straddle the border between gtfC or spcr and upstream or downstream flanking regions of gtfC. The primer sets 'gtfC up-forward and gtfC up-reverse' and 'gtfC down-forward and gtfC down-reverse' are specific for gtfC, and 'gtfC up-forward and spcr2-reverse' and 'spcr2-forward and gtfC down-reverse' are specific for spcr.

2. Genomic DNA Extraction from S. mutans

  1. Streak stock S. mutans UA159 onto a brain heart infusion (BHI) agar plate. Incubate the plate overnight at 37 °C under anaerobic conditions.
  2. Pick up a single colony using a sterilized toothpick and inoculate it into 5 mL of BHI broth. Incubate the S. mutans culture overnight at 37 °C under anaerobic conditions.
  3. Centrifuge the bacterial cell culture for 15 min at 2,000 × g. Resuspend the cell pellet in 5 mL of phosphate-buffered saline (PBS).
  4. Centrifuge for 15 min at 2,000 × g. Resuspend the cell pellet in 200 µL of PBS.
  5. Extract genomic DNA from the suspension using a bead-beating-base genomic DNA extraction kit according to the instructions provided by the manufacturer.
    1. Transfer the suspension to a 2.0-mL sample tube containing glass beads (included in the kit). Add 750 µL of lysis solution (included in the kit) to the cell suspension.
    2. Cap tightly and place the tubes symmetrically in the tube holder of the bead-beating disruption apparatus. Process at the maximum speed for 5 min.Centrifuge the bead-beaten samples for 1 min at 10,000 × g. Transfer the supernatant to the spin filter (included in the kit) in a 2.0-mL collection tube and centrifuge for 1 min at 7,000 × g.
    3. Add 1,200 µL of DNA binding buffer (included in the kit) to the filtrate. Transfer 800 µL of the mixture to the spin column (included in the kit) to a 2.0-mL collection tube and centrifuge for 1 min at 10,000 ×g.
    4. Discard the flow-through, add 200 µL of pre-wash buffer (included in the kit) to the spin column to wash the column matrix, and centrifuge for 1 min at 10,000 × g. Discard the flow-through, add 500 µL of wash buffer (included in the kit) to the spin column to wash the column matrix, and centrifuge for 1 min at 10,000 × g.
    5. Place the spin column into a new 1.5-mL microcentrifuge tube and add 100 µL of elution buffer (included in the kit) to the column matrix.
    6. Centrifuge for 30 s at 10,000 × g to elute the genomic DNA. Estimate the DNA concentration and purity by measuring the absorbance at 260 nm and 280 nmusing a spectrophotometer and confirm that the A260/A280 ratio is greater than 1.8.

3. PCR Amplification

  1. Perform the 1st PCR using the S. mutans WT genome and the synthetic spcr gene as PCR templates (see Table 1). Amplify the upstream flanking region of the gtfC gene, the downstream flanking region of the gtfC gene, and the spcr gene using the three sets of primers described above (Figure 1A), as per Table 2 and Table 3.
    NOTE: PCR primers, reagents, and amplification cycles are summarized in Table 1, Table 2, and Table 3, respectively.
  2. Fractionate each PCR product on a 1% agarose gel and excise the corresponding bands using a gel band cutter.
  3. Purify each amplified DNA product from the gels using a spin column- and silica membrane-based gel extraction kit.
    1. Transfer the gel slices to a clean microcentrifuge tube and mix with 500 µL of binding buffer (included in the kit). Incubate the mixture at 55 °C for 15 min until the gel slices are completely dissolved.
    2. Place the spin column (included in the kit) into a collection tube (included in the kit), load the sample onto the spin column, and centrifuge for 30 s at 11,000 × g. Discard the flow-through, add the 600 µL of Wash Buffer (included in the kit) to the Spin Column to wash the silica membrane, and centrifuge for 30 s at 11,000 × g.
    3. Discard the flow-through and centrifuge for 2 min at 11,000 × g to dry the silica membrane.
    4. Place the spin column into a new 1.5-mL microcentrifuge tube, add 50 µL Elution Buffer (included in the kit), and incubate at room temperature for 2 min.
    5. Centrifuge for 2 min at 11,000 × g to elute the amplified DNA. Estimate the DNA concentration and purity by measuring the absorbance at 260 nm and 280 nmusing a spectrophotometer and confirm that the A260/A280 ratio is greater than 1.8.
  4. Perform the 2nd PCR of 2-step fusion PCR using the three approximately equimolar fragments as PCR templates, as per Table 2 and Table 3.
    NOTE: These fragments were amplified and spliced using the nested primers 'N_up-forward and N_down-reverse' or the outermost primers 'up-forward and down-reverse' (Figure 1B). PCR primers, reagents, and amplification cycles are summarized in Table 1, Table 2, and Table 3, respectively.
  5. Load one-tenth of the PCR reaction mixture (5 µL) on a 0.8% agarose gel and compare the amplified band size with the expected band size to confirm the generation of the appropriate amplicon (Figure 1C).
  6. Concentrate the remaining final PCR product by ethanol precipitation without purification.
    1. Add 55 µL of ultra-pure water to the remaining PCR mixture to adjust the total volume to 100 µL.Add a one-tenth volume of 3 M sodium acetate (10 µL), pH 5.2, followed by 2.5 volumes of 100% ethanol (250 µL). Mix and freeze for 30 min at -80 °C.
    2. Centrifuge for 20 min at 15,000 × g at 4 °C, check for the pellet on the bottom of tube, and discard the supernatant.Wash the pellet with 1 mL of 70% ethanol, centrifuge for 5 min at 15,000 × g at 4 °C, and discard the supernatant. Air-dry the pellet for approximately 30 min and dissolve with 10 µL of ultra-pure water.

4. Competent Cell Preparation and Cell Transformation

  1. Streak stock S. mutans UA159 onto a BHI agar plate. Incubate the plate overnight at 37 °C under anaerobic conditions.
  2. Pick up a single colony using a sterilized toothpick and inoculate it into 5 mL of BHI broth. Incubate the S. mutans culture overnight at 37 °C under anaerobic conditions.
  3. Transfer 2 mL of the S. mutans culture to 50 mL of BHI broth and incubate for 6-8 h at 37 °C to an optical density at 600 nm (OD600) of 0.2-0.4 under anaerobic conditions.
  4. Centrifuge the cells for 15 min at 2,000 × g at 4 °C, discard the supernatant, and wash the cells twice with 40 mL of ice-cold water followed by 40 mL of 10% glycerol.
    NOTE: Residual substances affect subsequent electroporation.
  5. Aspirate the supernatant carefully with a Pasteur pipette as the adherence of the cell pellet in 10% glycerol is reduced. Resuspend the cells in 1 mL of fresh 10% glycerol, dispense 50 µL of the suspension into each 1.5-mL microcentrifuge tube, and store at -80 °C until just before use.
  6. Mix the 50 µL aliquot of ice-cold competent cells with 5 µL of the disruption construct described above in section 3. Add the mixture to electroporation cuvettes (with a 0.2 cm distance between electrodes). Employ the Staphylococcus aureus mode (1.8 kV, 600 Ω, 10 µF, 1 pulse) of the electroporation apparatus to electroporate.
  7. Suspend the cells in 500 µL of BHI broth immediately after electroporation and add 50 µL of the suspension to spectinomycin-containing BHI-agar plates.
    NOTE: Extra incubation time after electroporation is not required. However, incubation for 1-2 h after electroporation may improve transformation efficiency.
  8. Incubate the plate for 2-6 days at 37 °C under anaerobic conditions.
    NOTE: S. mutans ΔgtfB is constructed as described above. The entire coding region of the gtfB gene is replaced with the erythromycin resistance gene8 de S. mutans ΔgtfB. Each S. mutans strain is cultured in BHI broth at 37 °C under anaerobic conditions.

5. Verification of Gene Disruption and Storage

  1. Pick random colonies and inoculate them into the PCR mixture to perform colony PCR as per Table 2 and Table 3. PCR primers, reagents, and amplification cycles are summarized in Table 1, Table 2, and Table 3, respectively.
  2. Load the PCR reaction mixture on a 1% agarose gel to confirm the spcr-specific DNA band.
  3. Pick the positive colony using a sterilized toothpick and subculture cells in 10 mL of spectinomycin-containing BHI broth for 2 days at 37 °C under anaerobic conditions.
  4. Verify the generation of S. mutans ΔgtfC.
    1. Divide the cell suspension equally. Extract genomic DNA from the cells described above (steps 2.3. to 2.5.5.). Perform PCR with genomic DNA as the PCR template, using primers for the verification of gtfC disruption (Table 1) as per Table 2 and Table 3.
      NOTE: The PCR primers, reagents, and amplification cycles are summarized in Table 1, Table 2, and Table 3, respectively.
    2. Load the PCR mixture on a 2% agarose gel and compare the amplified band size with the expected band size to confirm the generation of the appropriate amplicon.
    3. Centrifuge the remaining cell suspension for 15 min at 2,000 × g at 4 °C. Resuspend the cell pellet in 5 mL of PBS.
    4. Centrifuge for 15 min at 2,000 × g at 4 °C. Resuspend the cell pellet in 1.5 mL of BHI broth containing 25% glycerol and store in -80°Cor -20 °C.

6. Phenotypic Analysis

  1. Streak each S. mutans strain onto a BHI agar plate. Incubate the plate overnight at 37 °C under anaerobic conditions.
  2. Pick up a single colony using a sterilized toothpick and inoculate it into 2 mL of BHI broth with or without an appropriate antibiotic. Incubate overnight at 37 °C under anaerobic conditions.
  3. Inoculate 20 µL of the overnight culture suspension into 2 mL of BHI broth containing 1% or 5% sucrose without antibiotics in a glass test tube; culture the cells with the test tube in an inclined position overnight at 37 °C under anaerobic conditions.
  4. Vortex the glass test tubes for 10 s and decant culture suspensions. Wash the test tubes three times with distilled water. Add 1 mL of 0.25% Coomassie brilliant blue (CBB) to stain the biofilms on the tube wall, and then incubate for 1 min.
  5. Decant the staining solution, wash the test tubes three times with distilled water, and dry the test tubes.
  6. Evaluate both color density and extension of the CBB stained-biofilm visually to determine the biofilm-forming ability in a phenotypic analysis.

Representative Results

Figure 2 shows that the size of each product from the 1st PCR, as observed on the 1% agarose gel, was in good agreement with the predicted size of approximately 1 kb. Figure 3 shows the gel electrophoresis analysis of the products of the 2nd PCR. Figure 4 shows S. mutans colonies transformed with the disruption construct, and a gel electrophoresis analysis of the colony PCR products. The amplicons from all colonies were of the predicted size. Figure 5 shows the primer-binding sites for the verification of gtfC disruption and gel electrophoresis of the PCR products. PCR products obtained by amplification using the gtfC-specific primer set were confirmed in S. mutans WT, but not in S. mutans ΔgtfC, whereas PCR products obtained using the spcr-specific primer set were confirmed in S. mutans ΔgtfC, but not in S. mutans WT. Figure 6 shows the sucrose-derived biofilm-forming ability of each S. mutans strain. An adherent biofilm was formed by S. mutans WT in the presence of sucrose; the adherent biofilm-forming ability of S. mutans ΔgtfB was lower than that of S. mutans WT. S. mutans ΔgtfC exhibited very low adherent biofilm formation in the presence of sucrose.

Figure 1
Figure 1:Strategy for 2-step fusion PCR. A schematic illustration of S. mutans ΔgtfC construction is shown. The gene lengths are not to scale. (A) Upstream and downstream flanking regions of the gtfC and spcr loci were amplified by PCR. The primer binding sites in the template are indicated by identical patterns. (B) The second PCR step was performed using (as templates) the 3 fragments that were amplified in the first PCR step with nested primers. (C) The disruption construct was obtained for homologous recombination in the bacterial strains. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Representative gel electrophoresis of products from the 1st PCR. Amplicons of the upstream flanking region of gtfC and downstream flanking region of gtfC and spcr are shown. M: molecular marker. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Representative gel electrophoresis of products from the 2nd PCR. Products amplified with the nested primers and the outermost primers are shown. The solid arrow indicates the predicted size of the disruption construct. M: molecular marker.

Figure 4
Figure 4: Screening for gtfC disruption by colony PCR (A). S. mutans colonies on the spectinomycin-containing BHI-agar plate; each circled number indicates colony ID. (B) Representative gel electrophoresis of colony PCR products; each circled lane number indicates the corresponding colony ID in Figure 4A. M: molecular marker, WT: Wild-type genomic DNA used as template. Please click here to view a larger version of this figure.

Figure 5
Figure 5: Verification of gtfC disruption by PCR. (A) Primer-binding sites; gene length is not to scale. PCR was performed using S. mutans genomic DNA as a template. Primer sets: gtfC up-forward and gtfC up-reverse (specific for gtfC); gtfC down-forward and gtfC down-reverse (specific for gtfC); gtfC up-forward and spcr2-reverse (specific for spcr); spcr2-forward and gtfC down-reverse (specific for spcr). (B) Representative gel electrophoresis of the PCR products; each circled lane number indicates the corresponding primer set in Figure 5A. A single electrophoretic image is divided to label the marker bands. M: molecular marker (100-base pair ladder). Please click here to view a larger version of this figure.

Figure 6
Figure 6: Phenotypic analysis based on biofilm development. Sucrose-derived biofilms formed by each S. mutans strain were stained with Coomassie brilliant blue. WT: S. mutans WT, ΔgtfB: S. mutans ΔgtfB, ΔgtfC: S. mutans ΔgtfC. Please click here to view a larger version of this figure.

Primer pair Sequence (5' to 3') Expected band size (bp)
2-step PCR for gtfC disruption
1st PCR
up-forward
up-reverse
AAGATATTTTGATAAGCAATCTGGGAACATGTATC
CGAACGAAAATCGATATTTCCTCCAAAAATAGTTA
1,036
spcr-forward
spcr-reverse
ATTTTTGGAGGAAATATCGATTTTCGTTCGTGAAT
CTTCTAAGATAAGTACATATGCAAGGGTTTATTGT
1,188
down-forward
down-reverse
AAACCCTTGCATATGTACTTATCTTAGAAGAATAG
TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC
1,059
2nd PCR
N_up-forward
N_down-reverse
TTTTATTGAAAACGAAGAAGGTAAATGGCTGTATC
GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG
3,132
Verification of gtfC disruption
Colony PCR for screening
S_spcr-forward
S_spcr-reverse
GGATCAGGAGTTGAGAGTGGACTAAAACCAAATAG
CAGCCACTGCATTTCCCGCAATATCTTTTGGTATG
535
Final verification
gtfC up-forward
gtfC up-reverse
TACGGCCGTATCAGTTATTACGATGCTAACTCTGG
GGTTGGTTGAGATGTTGCTGAAGTTGCTGTACTTG
498
gtfC down-forward
gtfC down-reverse
GCCTTAATTGGTTGGCATGTTGTTGAAGGAAGACG
TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG
557
gtfC up-forward
spcr2-reverse
Described above
CCACTCTCAACTCCTGATCCAAACATGTAAGTACC
641
spcr2-forward
gtfC down-reverse
GTGGCTGAATCTTCTCCATTAGAACATAGGGAGAG
Described above
623

Table 1: Primers used in this protocol. The underlined sequences of 'up-reverse and spcr-forward' and 'spcr-reverse and down-forward' are complementary. The bold-typed sequences of 'up-reverse and spcr-forward' and 'spcr-r and down-forward' are complementary.

Reagent Concentration of stock solutions Volume Final concentration
DNA polymerase premix 25 μL
Forward primer 5 µM 2 μL 0.2 µM
Reverse primer 5 µM 2 μL 0.2 µM
Template DNA Variable Variable Variable * ** ***
Deionized water up to 50 μL

Table 2: PCR reagents. *For 1st step PCR; 100 ng. **For 2nd PCR; each 30-50 ng of 1st step PCR amplicon. ***For colony PCR; direct addition of bacterial cells to the reaction mixture.

Cycle step Temperature Time Number of Cycles
Initial Denaturation 98 °C 2 min 1
Denaturation
Annealing
Extension
98 °C
55 °C
72 °C
10 s
5 s
Amplicon dependent
(1 min/1 kbp)
35
Final Extension 72 °C Amplicon dependent
(1 min/1 kbp)
1

Table 3: PCR amplification cycles.

Discussion

In the present protocol, the primers for the 1st PCR must be designed to amplify approximately 1 kb upstream and downstream flanking regions of the target region in the genome. Such long flanking sequences are necessary to improve the efficiency of homologous recombination.

The sequences of the primers (up-reverse, down-forward, spcr-forward, and spcr-reverse) in this protocol were automatically determined based on the site of incorporation of the disruption construct. Each primer includes 15 bases complementary to the end of the 2nd PCR template at the 5' region. A longer binding site enables more efficient production of the disruption construct. Inclusion of at least 10 complementary bases at the 5' region of each primer is recommended9.

Nested primers (N_up-forward and N_up-reverse) were used for the 2nd PCR, rather than the outermost primers (up-forward and down-reverse). The use of the outermost primers for the 2nd PCR is beneficial in some cases; successful amplification of the disruption construct for S. mutans ΔgtfB was achieved using the outermost primers (data not shown). However, the use of the outermost primers for the 2nd PCR step frequently results in insufficient PCR amplification, as shown in Figure 3. The use of nested primers was found to resolve this problem9. When the disruption construct is not substantially amplified even using the nested primers, however, redesign of the primers used in the 1st PCR may be required.

Colony PCR enables convenient screening of the gene-disrupted strain. Primers of known sequences may be applied for the generation of the gene-disrupted strain using spcr. Electroporation was used for the introduction of disruption constructs into S. mutans WT, as the transformation efficiency achieved using electroporation is generally higher than that enabled by other procedures. Transformation using horse serum, or horse serum with competence-stimulating peptides, is widely accepted in Streptococcus10,11,12. Although an electroporation apparatus is required, the procedures involved, such as competent cell preparation, are much simpler than those in alternative methods10,11. In addition, electroporation is recommended from the point of view of animal welfare.

The present protocol is applicable to multiple gene disruption, depending on the number ofantibiotic markers. To generate both gtfC– and gtfB-disrupted S. mutans strains, for example, the DNA construct for gtfC-disruption constructed by 2-step PCR may be transformed into S. mutans ΔgtfB. Because gtfC and gtfB are adjacent in this case, S. mutans ΔgtfC and S. mutans ΔgtfB genomes must be used as templates for 2-step PCR to maintain the homologous sequences for homologous recombination. In fact, double gene-disrupted S. mutans strain was previously constructed by this protocol9.

The present protocol for gene disruption in S. mutans may be adapted for the generation of gene-disrupted strains of various species. This protocol does not require the gene cloning step involved in conventional protocols. In addition, PCR is the only required enzymatic reaction; therefore, plasmid vectors, Escherichia coli, ligase, and restriction enzymes are not necessary. Furthermore, the present protocol offers greater flexibility in terms of design of the disruption construct, as the construct design is independent of restriction enzyme sites of the target gene. Researchers may determine regions that are deleted or preserved in the genome to design the reverse primer for amplification of the upstream flanking regions and the forward primer for amplification of the downstream flanking regions. These flanking regions are immediately upstream and immediately downstream of the region of DNA desired for deletion, respectively. Such flexibility may be used to decrease external influences, such as polar effects, on the expression of proximate genes.

Divulgaciones

The authors have nothing to disclose.

Acknowledgements

This work was supported by the Japan Society for the Promotion of Science [Grant Numbers 16K15860 to T.M. and 15K15777 to N.H.].

Materials

Streptococus mutans Stock strain in the lab. Wild-type strain (Strain UA159)
Genomic DNA extraction kit Zymo Research D6005
Bead-beating disruption apparatus Taitec GM-01
Synthetic genes Eurofins Genomics Custom-ordered Spectinomycin- and erythromycin-resistance gene
Thermal cycler Astec PC-708
PCR primers Eurofins Genomics Custom-ordered 35 bases in length
DNA polymerase Takara R045A High-fidelity DNA polymerase
Gel extraction kit Nippon Genetics FG-91202 DNA extraction from agarose gel
Gel band cutter Nippon Genetics FG-830
Spectrophotometer Beckman Coulter DU 800
Electroporator Bio-rad 1652100
Electroporation cuvette Bio-rad 1652086 0.2-cm gap
Anaeropack Mitsubishi Gas Chemical A-03 Anaerobic culture system
Brain heart infusion broth Becton, Dickinson 237500 Bacterial culture media
Spectinomycin Wako 195-11531 Antibiotics
Erythromycin Wako 057-07151 Antibiotics
Sucrose Wako 196-00015 For biofilm development
CBB R-250 Wako 031-17922 For biofilm staining

Referencias

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77 (1), 61-68 (1989).
  2. Horton, R. M., Cai, Z., Ho, S. M., Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques. 54 (3), 129-133 (2013).
  3. Kuwayama, H., et al. PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Res. 30 (2), E2 (2002).
  4. Sakurai, I., Mizusawa, N., Wada, H., Sato, N. Digalactosyldiacylglycerol is required for stabilization of the oxygen-evolving complex in photosystem II. Plant Physiol. 145 (4), 1361-1370 (2007).
  5. Aoki, H., Shiroza, T., Hayakawa, M., Sato, S., Kuramitsu, H. K. Cloning of a Streptococcus mutans glucosyltransferase gene coding for insoluble glucan synthesis. Infect Immun. 53 (3), 587-594 (1986).
  6. Hanada, N., Kuramitsu, H. K. Isolation and characterization of the Streptococcus mutans gtfC gene, coding for synthesis of both soluble and insoluble glucans. Infect Immun. 56 (8), 1999-2005 (1988).
  7. LeBlanc, D. J., Lee, L. N., Inamine, J. M. Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis. Antimicrob Agents Chemother. 35 (9), 1804-1810 (1991).
  8. Macrina, F. L., Tobian, J. A., Jones, K. R., Evans, R. P., Clewell, D. B. A cloning vector able to replicate in Escherichia coli and Streptococcus sanguis. Gene. 19 (3), 345-353 (1982).
  9. Murata, T., Hanada, N. Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans. FEMS Microbiol Lett. 363 (11), (2016).
  10. Perry, D., Wondrack, L. M., Kuramitsu, H. K. Genetic transformation of putative cariogenic properties in Streptococcus mutans. Infect Immun. 41 (2), 722-727 (1983).
  11. Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., Cvitkovitch, D. G. PCR ligation mutagenesis in transformable streptococci: application and efficiency. J Microbiol Methods. 49 (2), 193-205 (2002).
  12. Ge, X., Xu, P. Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR. J Vis Exp. (69), (2012).

Play Video

Citar este artículo
Murata, T., Okada, A., Matin, K., Hanada, N. Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning. J. Vis. Exp. (128), e56319, doi:10.3791/56319 (2017).

View Video