Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors

All of the human PB samples were obtained from anonymous adult donors with no identification information available from Tianjin Blood Center with approval of the local research ethics committee.

1. Endo-free Plasmid Preparation

1. Use a commercial Plasmid Purification Maxi Kit to extract episomal vectors from E. coli according to manufacturer's protocol. For the final step, substitute TE buffer with endotoxin-free sterile water to dissolve the DNA pellet.
2. Measure DNA concentration using a commercial UV/Vis spectrophotometer. The concentration is usually greater than 1 µg/µL, with A260/A280 and A260/A230 ratios greater than 1.8 and 2.0, respectively.

2. Culture Media

1. Prepare erythroid medium: Hematopoietic Stem Cell Expansion Medium supplemented with 100 ng/mL human Stem Cell Factor (SCF), 10 ng/mL Interleukin-3 (IL3), 2 U/mL Erythropoietin (EPO), 20 ng/mL Insulin Growth Factor-1 (IGF1), 1 µM dexamethasone and 0.2 mM 1-thioglycerol. Filter sterilize with a 0.22 µm syringe filter. Erythroid medium can be stored at 4 °C for up to one month.
2. Prepare iPSC medium: DMEM/F12 medium (Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12) supplemented with 1x L-glutamine, 1x penicillin/streptomycin, 1x non-essential amino acids solution, 50 ng/mL Fibroblast Growth Factor 2 (FGF2), 1x Insulin-Transferrin-Selenite supplement (ITS), and 50 mg/mL ascorbic acid. Filter sterilize with a 0.22 µm syringe filter. iPSC medium can be stored at 4 °C for up to one month.
3. Prepare MEF medium: Dulbecco's Modified Eagle Medium (DMEM; high glucose) supplemented with 1x penicillin/streptomycin and 10% Fetal Bovine Serum (FBS). Filter sterilize with a 0.22 µm syringe filter. MEF medium can be stored at 4 °C for up to one month or freshly add 1x L-glutamine before use.
4. Prepare iPSC cryopreservation medium (2x): Dissolve 5 g of D-trehalose in 30 mL of sterile water in a 37 °C water bath. Bring the temperature to 4 °C and then add 10 mL of FBS and 10 mL of dimethylsulfoxide (DMSO). Filter sterilize with a 0.22 µm syringe filter. Store at 4 °C for up to 3 months²⁴.

3. Isolation of Peripheral Blood Mononuclear Cells (PB MNCs)

1. Combine 10 mL fresh PB sample and 10 mL PBS buffer into a 50 mL tube and mix well. Bring PBS to RT or 37 °C prior to use.
   NOTE: Approximately 1 – 3 x 10⁶ MNCs (fresh or cryopreserved) can be obtained from 1 mL of PB. After 6 d of culture, expect to have 0.5 – 1 x 10⁶ total cells due to death of mature cells during culture. Approximately 1 x 10⁷ cells can be obtained from 10 mL of fresh PB.
2. Add 10 mL Ficoll to the bottom of the tube using a 10 mL syringe attached to a long needle. This process should be done slowly to ensure that the Ficoll layer does not mix with the PB.
3. Centrifuge at 400 x g for 30 min at a low acceleration and deceleration rate. After centrifugation, the PB MNCs are in the white layer (buffy coat) located between the PB plasma and the Ficoll.
4. Slowly aspirate ~10 mL PB plasma without disturbing the buffy coat layer. Carefully harvest the white layer using a 1 mL pipette tip to a new 50 mL tube. The total volume of collected cells from the white layer will be between 3 – 6 mL.
5. Add PBS to bring the total volume to 30 mL and mix well with a 10 mL pipette. Centrifuge at 400 x g for 10 min.
6. Remove the supernatant and resuspend cell pellet in 20 mL culture medium (i.e. Iscove's Modified Dulbecco's Medium, IMDM) and mix well. Centrifuge at 400 x g for 10 min to remove the majority of the platelets.
7. Remove the supernatant and resuspend the cell pellet in 1 – 2 mL IMDM. Cells may be used for immediate culture, or frozen-down for later use. For cryopreservation, add an equal amount of cryopreservation medium. Aliquot cells in cryovials (0.5 – 1 mL per vial) and transfer cryovials to a -80 °C freezer immediately. PB MNCs may be stored in -80 °C freezer for several weeks or transferred to a liquid nitrogen tank for long-term storage.
   NOTE: When thawing the frozen cells, though our cryopreservation medium may sustain cell viability, the cell number may decrease due to cell death during the thawing process. It is recommended that 1 – 10 x 10⁷ cells will be frozen in each vial.

4. Expansion of PB MNCs in Erythroid Medium

1. Prepare 5 mL IMDM medium in a 15 mL tube. Quickly thaw the frozen PB MNCs in a 37 °C water bath and then transfer them to the tube with the IMDM medium.
   NOTE: The length of time in water bath depends on the volume of the cryopreserved cells and the cryovial used. Usually, the frozen cell will thaw within 1 min.
2. Centrifuge at 400 x g for 5 – 10 min. Remove the supernatant and resuspend the cell pellet in erythroid medium. Add 10 µL Trypan Blue solution to 10 µL cell suspension and mix well. Trypan Blue stains dead cells within 1 – 3 min. Count the cells under the microscope using a hemocytometer.
3. Culture PB MNCs in a non-tissue culture (non-TC) treated 6-well plate with 2 mL medium per well, at a cell density of ~5 x 10⁶ cells/mL, at 37 °C in a 5% CO₂ humidified incubator.
4. Add 1 mL fresh erythroid medium directly to each well without changing the medium at D 3 and 5.
5. At D 6, harvest the PB MNCs for nucleofection.

5. PB MNC Nucleofection and Reprogramming

1. One day before nucleofection, pre-coat TC-treated 6-well plates with 0.1% gelatin at 37 °C for 20 min. Thaw inactivated Murine Embryonic Fibroblast (MEF) feeder cells in a 37 °C water bath and immediately transfer them to a 15 mL tube containing 5 mL of MEF medium.
2. Centrifuge at 400 x g for 5 min and remove the supernatant. Remove the gelatin from the 6-well plate, resuspend the cell pellet in MEF medium, and transfer them to the gelatin pre-treated 6-well plate. In each well, seed 2 – 4 x 10⁵ inactivated MEF cells suspended in 2 mL MEF medium.
3. Culture the MEF feeder cells at 37 °C in a 5% CO₂ humidified incubator.
4. On the day of nucleofection, aspirate the MEF medium and replace it with 1 mL erythroid medium. Pre-equilibrate the culture plate for 10 – 30 min at 37 °C in a 5% CO₂ humidified incubator.
5. Add 2 µg pEV-OCT4-2A-SOX2, 1 µg pEV-MYC, 1 µg pEV-KLF4, and 0.5 µg pEV-BCL-XL in a 1.5 mL sterile Eppendorf tube. Heat the tube at 50 °C for 5 min to prevent contamination, and cool down to RT. Add 57 µL nucleofection buffer and 13 µL supplement.
6. Harvest 2 x 10⁶ cultured PB MNCs to a 5 mL tube by centrifuging at 200 x g for 7 min. Remove the supernatant and add the plasmid and nucleofection buffer mix to the cell pellet. Mix well by flicking the tube with your finger.
   NOTE: As low as 2 x 10⁵ cells may be used for nucleofection, but a lower reprogramming efficiency should be expected as well.
7. Transfer the DNA and cell suspension to the cuvette provided in the kit and cap the cuvette. Select the Program U-008 on the nucleofection device. Insert the cuvette into the holder and press OK to apply the U-008 program.
8. Take the cuvette out of the holder, add 0.5 – 1 mL pre-warmed erythroid medium in each cuvette, and transfer cells to the pre-equilibrated MEF plate immediately. Due to the high reprogramming efficiency and donor variation, seeding different numbers of cells ranging from 1-10 x 10⁵ cells per well is highly encouraged.
9. Transfer the plate to a hypoxia chamber, and flush the chamber with a mixed gas composed of 92% N₂, 5% CO₂ and 3% O_2, for 1 – 2 min at a rate of 20 L/min. After sealing the chamber, culture the cells at 37 °C.
10. At D 2 post-nucleofection, add 2 mL iPSC medium directly to each well.
11. At D 4 post-nucleofection, remove 3 mL of medium and add 2 mL fresh iPSC medium. At D 4 post-nucleofection, most of the live cells will have attached to the feeder layer.
12. After D 6 post-nucleofection, change the medium every 2 d by leaving 500 µL spent medium and adding 2 mL fresh E8 medium supplemented with 0.25 mM Sodium Butyrate until D 14 – 18.
    NOTE: Additional feeder cells may be added in the culture wells whenever observing that the feeder cells have been detached. After thawing MEFs (see 5.1 and 5.2), resuspend the cell pellet in a small volume of E8 medium (i.e. ~0.2 mL for one well of a 6-well plate) and then add MEFs into the culture wells. Approximately 2% FBS may be added to increase cell attachment. Alternatively, MEF-conditioned medium can also be used, but it is more laborious.

6. Expansion of iPSCs

NOTE: In most cases, large numbers of iPSC colonies appear at D 8 – 10 post nucleofection. After D 14, big iPSC colonies are usually ready for picking.

1. Before picking colonies, add 500 µL E8 medium supplemented with ROCK inhibitor, Y27632 (10 µM), in one well of a feeder or Matrigel coated 24-well plate. Use a 10 or 20 µL pipette to scratch and pick colonies under the microscope. Transfer the pieces of each colony to the wells containing the culture medium.
   NOTE: The concentration of Matrigel differs from one batch to another. Usually, we use 1:100 dilution of Matrigel.
   1. In order to avoid cross-contamination, pick colonies that are large and well separated from others. Culture iPSCs at 37 °C in a 5% CO₂ humidified incubator.
      NOTE: It should be note that the iPSC population may be polyclonal due to cell migration when there are dozens or hundreds of colonies in each well of a 6-well plate.
2. Do not change medium for the first 2 d. ROCK inhibitor can promote survival of small colonies²⁵.
3. From D 2 onwards, change medium every day by removing spent medium and adding 500 µL fresh E8 medium in each well.
4. Approximately 1 week later, when the colonies are large enough, remove the medium and treat the cells with 300 µL cell detachment solution (0.5 mM EDTA in PBS) at 37 °C for 1 – 3 min. Remove the cell detachment solution and add E8 medium containing ROCK inhibitor (10 µM) to suspend iPSCs. Do not break down colonies into single cells, which may lead to excessive cell death. The cell clumps with 5 – 50 cells are suitable for iPSC passage.
5. Transfer 50 - 100% of the cell suspension to each well of a 12- or 6-well plate that has been precoated with feeders or Matrigel.
6. For long-term culture in Matrigel-coated plates (see note in 6.1), change the medium every day. When the cell confluency reaches 40 – 60%, treat the cells with 1 mL cell detachment solution (0.5 mM EDTA in PBS) at 37 °C for ~3 min. When the colonies start to curl up, remove the cell detachment solution and add E8 medium containing ROCK inhibitor (10 µM) to suspend the iPSCs. Passage cells with a splitting factor of 4 – 8. the ROCK inhibitor should be added when passaging cells to increase survival, and removed 1 d later to prevent differentiation.
7. To freeze-down iPSCs, treat cells with cell detachment solution at 37 °C for 3 – 5 min according to manufacturer's protocol. When iPSC colonies start to curl up, aspirate the buffer and add 0.5 – 1 mL E8 medium.
8. Add an equal volume of cryopreservation medium to the cell suspension and mix well. Frozen iPSCs can be stored in a -80 °C freezer for several weeks or in liquid nitrogen for long-term storage.

7. Selection of iPSCs without Residual Episomal Plasmids

1. After passage 5, harvest iPSCs and extract genomic DNA.
   NOTE: Usually after 5 passages of culture, residual episomal plasmids are undetectable. Thus, almost all of the iPSC colonies at passages above 5 (i.e. passage 10) are lacking residual episomal plasmids.
2. Use genomic DNA from untransfected PB MNCs as a negative control. Add 1.6 pg pEV-OCT4-2A-SOX2 plasmid into 1 µg negative control DNA to mimic cells with one copy of pEV plasmid per cell.
3. Add 9 µL PCR-grade water including 100 ng genomic DNA and 1 µL specific primers (10 µM each of forward and reverse primers) into 10 µL High-Fidelity PCR Master Mix. Normalize the amount of DNA by GAPDH. Use the following primers for PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
4. Incubate the reaction mixture at 98 °C for 60 s; followed by 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. After 30 cycles; extend the reaction at 72 °C for 5 min.
5. Load 5 µL PCR products in each well of a 1% agarose gel. Run the gel for 20 – 30 min at 100 V. Choose the iPSC clones with undetectable bands for EBNA1 and WPRE for further culture and downstream analysis.

8. Flow Cytometry

1. Harvest iPSCs by treating them with Accutase at 37 °C for 3 – 5 min to obtain a single cell suspension. Add 1 µL PE-conjugated anti-TRA-1-60 or eFluor 570-conjugated anti-SSEA4 or Isotypic antibody to 100 µL of cell suspension (1 – 5 x 10⁵ cells) in 5 mL tubes. Incubate the tubes in a dark location at RT for 20 min.
2. After staining for 20 min at RT, add 2 mL PBS and centrifuge at 400 x g for 5 min. Resuspend cells in 300 µL PBS for Fluorescence-activated Cell Sorting (FACS) analysis using a flow cytometry cell analyzer.^23,26

9. Confocal Imaging

1. Seed iPSCs in Matrigel coated chamber slides.
2. After 3 – 4 d of culture, remove the growth medium and fix with 4% paraformaldehyde (PFA) at RT for 30 min. Wash cells twice with PBS.
   Note: PFA is toxic and harmful.
3. Treat the cells with 0.1% Triton X-100 in PBS (PBS-T) at RT for 30 min. Wash the cells twice with PBS.
4. Block the cells with blocking buffer (5% goat serum in PBS, V:V) at RT for 1 h.
5. During the blocking step, dilute the primary antibody (100x) in blocking buffer.
   NOTE: The antibodies information is listed in the Table of Materials/Equipment.
6. Incubate cells with diluted antibody at 4 °C O/N.
7. Wash twice with PBS-T for 15 min, followed by twice with PBS for 15 min.
8. Incubate cells with a diluted fluorophore-conjugated secondary antibody at RT for 2 h.
9. Wash the cells twice with PBS-T for 15 min, followed by twice with PBS for 15 min.
10. Stain the nucleus with DAPI (1 µg/mL) in PBS at RT for 10 min.
11. Wash cells twice with PBS for 15 min.
12. Capture images with a confocal microscope.^23,27

10. Teratoma Assay

Harvest 1 x 10⁶ iPSCs with cell detachment solution (0.5 mM EDTA in PBS) and resuspend cells in 200 µL DMEM/F12 diluted (1:1) Matrigel.

1. Subcutaneously inject cells into the rear haunch of NOD/SCID immunodeficient mice.
2. At 8 – 12 week after iPSC injection, dissect and fix teratomas in 10% formalin.²⁸
3. After microsectioning and staining with hematoxylin and eosin (H&E), analyze samples.²⁹