RiboTag Immunoprecipitation in the Germ Cells of the Male Mouse

All animal use and handling practices have been approved by Rutgers University's Internal Animal Care and Use Committee (IACUC).

1. Mouse breeding

1. Breed female mice homozygous for an RNA binding protein mutation that leads to male infertility (manuscript in preparation, referred to herein as the gene of interest) in trio matings to males hemizygous for the Stra8-iCre allele (B6.FVB-Tg(Stra8-iCre)1Reb/LguJ) (Cre+), as pairing two females to every male increases breeding efficiency.
   NOTE: The mutant gene of interest (M) was passed maternally, as females homozygous for M have normal fertility. This has the added benefit of allowing paternal transmission of the male germ cell Cre (hemizygous), as recommended²¹ and optimizing the percent of offspring with the desired allelic combination. Because homozygous Cres exhibit germ cell toxicity²², it is recommended the allele be maintained and passed in a heterozygous or hemizygous state. Importantly, Cre expression must not co-occur with the Rpl22-HA allele until the experimental population. Failure to isolate the Rpl22-HA allele from Cre in breeding animals will result in offspring that globally express Rpl22-HA due to germ cell Cre activity. This issue is specific to germ cell. Additionally, the Stra8-iCre is specific to the authors' cell population of interest²², targeting cells transitioning into and very early in meiosis, including preleptotenes and leptotenes. A different Cre driver specific to another cell type of interest can be used instead. Common practice dictates male germ cell expressed Cres be transmitted on the paternal side. However, it is possible maternal transmission of the Stra8-iCre will result in similar transgene expression in male offspring. Regardless of breeding scheme selected, in order to generate offspring with equivalent Cre expression, all experimental samples should be generated via Cre transmission from the same parental side (either always maternal or always paternal).
2. Genotype resulting male pups as described in section 2.4. Select those carrying the M allele and positive for Cre (+/M:Cre+) for downstream breeding.
3. Breed female mice homozygous for the M allele in trio matings to males homozygous for Rpl22-HA (B6J.129(Cg)-Rpl22^tm1.1Psam/SjJ).
   NOTE: The Rpl22-HA background is highly mixed, so care should be exercised when assessing strain-specific phenotypes.
4. Genotype resulting female pups to identify those carrying the M allele and positive for Rpl22-HA (+/M:Rpl22-HA+) (see section 2.3). Select these females for downstream breeding.
5. Cross +/M:Cre+ males with +/M:Rpl22+ females in trio matings. Genotype the resulting pups (see sections 2.3 and 2.4) to identify males that are both Cre+ and Rpl22+ and either wildtype or M/M.
   NOTE: As this work focuses on a mutation resulting in complete male infertility, special considerations have been taken in the breeding scheme to most efficiently obtain desired experimental genotypes. Such considerations may be unnecessary in other experimental models. See Figure 2 for a full breeding schematic and accompanying legend for additional discussion of breeding considerations.

2. Sample collection

1. Collect testes from male mice at 21 days post-partum (dpp).
   1. Sacrifice mice by CO₂ inhalation followed by cervical dislocation. Make a ventral incision (3 cm) on each animal flanked by two shorter (2 cm each), connected lateral incisions. Pull the skin and peritoneum back to reveal the testes.
   2. Using forceps, pull the epidymal fat pad from one side of the body cavity to reveal the epididymis and testis. With tenotomy scissors, excise the testis, taking care to trim away epididymis, surrounding fat, and any external vasculature. Place intact testes in a clean 1.7 mL tube.
   3. Repeat with other side, adding the second testes to the first tube. Cap this tube and immediately submerge it in liquid nitrogen to flash-freeze.
      NOTE: Samples can be preserved at -80 °C until use.
2. Collect additional tail tip samples for each animal (2 mm) for genotyping confirmation.
   1. To extract DNA, add 100 µL of 50 mM NaOH to a 2 mm tail tip in a 1.7 mL tube and boil at 95 °C for 30 min. Add 100 µL of 50 mM HCl and 20 µL of 1 M Tris-HCl pH 8.0 and centrifuge samples for 3 min at 10,000 x g. Retain supernatant (containing genomic DNA) and store extracted DNA at 4 °C until use as template for the following genotyping reactions.
3. Perform Rpl22-HA genotyping following a method adapted from Sanz et al.¹³ using the following primers: forward: 5' GGGAGGCTTGCTGGATATG 3'; reverse: 5' TTTCCAGACACAGGCTAAGTACAC 3'.
   1. Prepare a reaction mixture consisting of 2 µL of DNA as extracted in step 2.2.1, 0.08 µL of 25 mM dNTPs, 0.1 µL of 10 mM forward primer, 0.1 µL of 10 mM reverse primer, 2 µL of a polymerase chain reaction (PCR) buffer (650 mM Tris pH = 8.8, 165 mM (NH₄)₂SO₄, 30 mM MgCl₂, and 0.1% Tween), 0.2 µL of Taq polymerase, and nuclease-free H₂O to a total volume of 20 µL.
   2. Use the following thermocycler conditions: a 30 s primer melting step at 95 °C, 30 s anneal at 64 °C and a 30 s elongation at 72 °C, repeated 37 times with a final 5 min elongation at 72 °C.
      NOTE: This yielded a product size of 260 bp for wildtype samples and 292 bp for samples that were Rpl22-HA+
4. Perform Cre genotyping using the following primers: forward: 5' GTGCCAGCTGAACAACAGGA 3'; reverse: 5' AGGGACACAGCATTGGAGTC 3'. Prepare the PCR reaction as described in step 2.3.2 utilizing the Cre primers instead. Use the following thermocycler conditions: a 30 s primer melting step at 95 °C, 30 s anneal at 60 °C and a 15 s elongation at 72 °C, repeated 35 times with a final 5 min elongation at 72 °C.
5. Carry out gene of interest genotyping as is standard for the gene in question.
   NOTE: The author's genotyping protocol utilizes a concentrated custom Taq, and as such, other users may have to modify the conditions to suit their enzymatic requirements. In order to better understand the impact of this gene of interest's loss on translation, males that were either wildtype or homozygous for the mutant allele of interest and that were also Cre+ and Rpl22+ were selected to be the experimental samples. Genotype selection is further discussed above in section 1.

3. Preparation of solutions

NOTE: Preparation of solutions and all subsequent steps must be done under stringently conditions.

1. To prepare homogenization buffer (HB), add 2.5 mL of 1 M Tris pH 7.4, 5 mL of 1 M KCl, 600 µL of 1 M MgCl₂, and 500 µL of NP-40 to a 50 mL tube. Bring to volume (50 mL) in diethyl pyrocarbonate (DEPC) H₂O and mix until all components are incorporated.
   NOTE: The final concentrations will be as follows: 50 mM Tris pH 7.4, 100 mM KCl, 12 mM MgCl₂, and 1% NP-40.
2. To prepare high salt wash buffer (HSWB), add 2.5 mL of 1 M Tris pH 7.4, 15 mL of 1 M KCl, 600 µL of 1 M MgCl₂, and 500 µL of NP-40 to a 50 mL tube. Bring to volume (50 mL) in DEPC H₂O and mix until all components are incorporated.
   NOTE: The final concentrations will be as follows: 50 mM Tris pH 7.4, 300 mM KCl, 12 mM MgCl₂, and 1% NP-40The protocol can be paused here, and solutions can be stored at room temperature until use.

4. Preparation of tissue

1. Preweigh all sample tubes, recording weight, and precool in liquid nitrogen.
2. Precool sterile mortar, pestle, and weighing spatula on dry ice.
3. Grind flash-frozen tissue samples to a fine powder using a precooled, sterile mortar and pestle on dry ice.
   1. Place flash frozen tissue into precooled mortar on dry ice. Gently break tissue into large pieces using pestle and grind slowly until tissue is a fine powder.
      NOTE: Although fresh tissue can also be used, as per the original protocol¹³, no significant difference in outcome is observed with the use of flash-frozen tissues. See Representative Results and Discussion for details.
   2. Carefully transfer ground sample to precooled collection tube by scraping powder from mortar using precooled spatula. Ensure only tissue is collected and not any moisture deposited onto the cold mortar.
   3. Weigh the tube with tissue, taking care to keep on dry ice whenever possible. Calculate the mass of tissue by subtracting initial weight of the tube from the weight of the tube with the sample in it. Record this value for later calculation of lysis buffer volumes.
      NOTE: The protocol can be paused here, and samples can be stored at -80 °C until use.

5. Homogenization of sample

1. Prepare lysis buffer (10 mL HB + supplements) by adding 10 µL of 1 M dithiothreitol (DTT), 1 protease inhibitor tablet, 50 µL of RNase inhibitor (40,000 units/mL), 200 µL of 5 mg/mL cycloheximide, and 100 µL of 100 mg/mL heparin to 10 mL of HB. Mix until all components are incorporated and keep on ice until use.
   NOTE: The final concentrations of the supplements in 10 mL HB will be as follows: 1 mM DTT, 200 U/mL RNase inhibitor, 100 µg/mL cycloheximide, and 1 mg/mL heparin. This solution must be used within 24 h of the addition of the supplements and can be kept at 4 °C or on ice until use.
2. For every 100 mg of sample, add 1 mL of lysis buffer. With the same pipette used to add the lysis buffer, carefully pipette the resulting lysate up and down to fragment cells and mix. Continue pipetting until the sample is no longer viscous, generally 25−30 strokes.
   NOTE: Because the solution is very viscous at first, a large diameter pipette should be used to mix the solution. A standard 1000 µL is normally sufficient for 100 mg of tissue.
3. Set samples on ice for 10 min to lyse. Then, spin samples in a precooled centrifuge (4 °C) for 10 min at 10,000 x g. A large, loose, cloudy pellet should form in the bottom of the tube.
4. Being careful not to disturb the pellet, collect the lysate into a new tube and record volume for each sample. To prevent sample degredataion, ensure that samples remain cool throughout the remaining protocol, storing on ice or at 4°C whenever possible.

6. Equilibration of beads

1. Using the volume of lysate from step 5.2, calculate the required volume of magnetic beads coupled to the appropriate antibody binding protein (in this case, protein G). For 1 mL of lysate, use 375 µL of protein G beads (30 mg/mL).
   NOTE: Choice of conjugated beads will vary with anti-HA antibody used; for example, if a rabbit-generated anti-HA antibody is selected, protein A beads will be preferable.
2. Using a magnetic tube rack, remove bead solvent and add an equal volume of fresh lysis buffer to the beads. Rotate 5 min at 4 °C to wash. Perform all rotation steps using a benchtop tube rotater set to 20 rpm.
3. Place the tube on the magnetic tube rack and remove the wash buffer.
4. Repeat steps 6.1−6.3 two more times.
5. Add lysis buffer at the original volume to equilibrated beads. Store at 4 °C or on ice until use.

7. Preclearing sample

1. Add 50 µL of equilibrated beads for every 1 mL of lysate to supernatant of lysed sample (lysate) and rotate at 4 °C for 1 h.
2. Place the tube on the magnet rack and collect lysate into a fresh tube. Discard used beads.
3. To the lysate add 25 µL of equilibrated beads for every 1 mL and rotate at 4 °C for 1 h. Store remaining equilibrated protein G beads at 4 °C overnight.
4. Place tube on the magnet rack and collect lysate into a fresh tube. Discard used beads. From the cleared lysate, retain 50 µL to act as sample input control. Store at -80 °C.
   NOTE: The input sample acts as a control representing the total RNA population of the sample, including RNAs associated with other cell types in the tissue, to be used during downstream analyses to correct for gene expression changes as a function of mutation.

8. Incubation of antibody

1. For every 1 mL of cleared lysate, add 5 µg of anti-HA antibody. To prevent sample loss, seal the tube cap with laboratory film. Rotate samples 16−18 h at 4 °C.
   NOTE: The antibody incubation time and concentration has not been optimized. The authors found an overnight incubation with 5 µg to be sufficient; however, it is possible that a shorter incubation or less antibody will be adequate, or that a longer incubation or more antibody will improve binding.

9. Incubation of beads

1. For every 1 mL of cleared lysate, add 300 µL of protein G beads. Reseal the tube cap with laboratory film and rotate for 2 h at 4 °C.

10. Washing of beads

1. Place the sample tube on the magnet rack to allow beads to separate from IPed lysate. Pipette off flow-through lysate and discard, retaining the beads.
2. Apply 800 µL of HSWB to beads and allow to rotate for 10 min at 4 °C. Place the sample tube on the magnet rack and allow beads to separate from wash. Remove and discard wash.
3. Apply another 800 µL of HSWB to beads. Close sample and allow to rotate for 5 min at 4 °C. Place the sample tube on the magnet rack and allow beads to separate from wash. Remove and discard wash.
4. Repeat step 10.3 once more.

11. RNA extraction

1. Place the sample tube on the magnet rack and allow beads to separate from wash. Pipette off and discard wash, retaining beads for RNA extraction. Add 3.5 µL of 14.2 M beta-mercaptoethanol (bME) to beads and mix by vortexing for 15 s.
2. Extract RNA using a commercial RNA purification kit, as per manufacturer's instructions. Elute sample in 30 µL of RNase free H₂O.
   NOTE: Though the 10 µL/sample DNase treatment is optional for most kits, it is strongly encouraged. This optional cleanup step significantly reduces background, allowing for a more accurate final concentration. It is strongly recommened to use a kit that contains beta-mercaptoethanol (bME) in the lysis buffer. bME acts as an additional RNase inhibitor to prevent sample degradation during RNA isolation.
3. Store sample at -80 °C or analyze immediately.

12. Quantification and sample analysis

1. Using a UV-Vis spectrophotometer, quantify RNA concentration and preliminary quality.
2. Analyze quality of RNA extracted from samples via a bioanalyzer.
   NOTE: The resulting RNA can then be used for RNA-sequencing or other downstream analyses such as northing blotting or quantitative reverse transcription PCR (qRT-PCR).