Combining Optogenetics with Artificial microRNAs to Characterize the Effects of Gene Knockdown on Presynaptic Function within Intact Neuronal Circuits

All experiments were carried out in accordance with the guidelines established by the European Communities Council (Directive 2010/63/EU of March 4, 2014), and were approved by the Italian Ministry of Health.

1. Design of microRNAs for RNA Interference and Evaluation of their Efficiency in Heterologous Expression Systems

NOTE: This protocol requires knowledge of the following well-established methods: molecular cloning, DNA sequencing, maintenance of cell lines, calcium phosphate transfection, quantitative real time PCR (qRT-PCR), preparation of cell lysates from cell lines and Western blotting.

1. Determine whether the gene of interest is subject to alternative splicing. For a general knockdown of the gene, select exclusively constitutive exons; for a knockdown of a specific alternatively spliced isoform, select the relevant alternatively spliced exon.
2. Use dedicated software (e.g. https://rnaidesigner.thermofisher.com/rnaiexpress/) to design artificial miRs for RNA interference against the sequence of interest.
   NOTE: It is important to use a Basic Local Alignment Search Tool (BLAST) to check for possible off-targets within the same species.
3. Select the top three ranked miRs for the target gene.
4. Order the top and bottom strands of the selected miRs from a suitable company. For negative control, use a scrambled version of one the selected miRs or a miR predicted not to target any known gene of the species used in the experiment (e.g. for vertebrate genes, the miR present in pcDNA6.2-GW/EmGFP-miR-neg).
5. Anneal the respective top and bottom strands of the selected miRs and clone them into a plasmid designed for expression of miRs (e.g. pcDNA6.2-GW/EmGFP-miR) using standard cloning strategies.
   NOTE: The aim is to create a miR expression cassette consisting of a 5' miR flanking region, the selected miR sequence and a 3' miR flanking region that can be expressed from the 3' UTR of a reporter gene under the control of a RNA polymerase type II promoter.
6. Use DNA sequencing to validate the correct insertion of the selected miRs.
7. Grow HEK293 cells in a humidified cell culture incubator (37 °C, 5% CO₂) using DMEM medium supplemented with 10% fetal bovine serum, 1 mM NaPyruvate, 10 mM HEPES (pH 7.39) and 1x penicillin/streptomycin (Pen/Strep).
8. When HEK293 cells are ~70% confluent, co-transfect them with each of the miR expression vectors and a vector expressing the targeted gene in a 1:1 DNA ratio using the calcium phosphate method⁶. Include the following controls: (i) untransfected cells, (ii) cells transfected with the vector expressing the targeted gene together with either carrier DNA (e.g. pBluescript II SK(+)) or (iii) miR Control.
   NOTE: (i) The expressed targeted gene must be from the same species towards which the miRs were designed, unless the sequences targeted by the miRs are absolutely conserved at the nucleotide level between the two species. (ii) Cell lines other than HEK293 can be used. (iii) Alternative methods of transfection, such as electroporation or liposome-based methods, can be used.
9. 48 h after transfection, lyse the cells, run protein gel, perform Western blot and analyze protein content with an antibody recognizing the target protein. Aim for a knockdown efficiency of ≥50%.
   NOTE: Knockdown efficiency can alternatively, or in addition, be evaluated (i) by ELISA analysis, (ii) by measuring the activity of the target protein if applicable (e.g. current densities for ion channels) or (iii) by qRT-PCR at the mRNA level if suitable antibodies are not available (protocol step 3).
   1. Place the culture dishes on ice and wash the cells once with ice-cold phosphate-buffered saline (PBS).
   2. Aspirate the PBS, then add ice-cold RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP40, 0.1% sodium dodecyl sulfate (SDS), containing protease and phosphatase inhibitors; 1 mL for a dish of Ø 100 mm, 0.5 mL for a dish of Ø 60 mm).
   3. Scrape adherent cells off the dish using a cell scraper and gently transfer the cell suspension into a pre-cooled microcentrifuge tube.
   4. Centrifuge the tube at 15,000 x g for 15 min at 4 °C, transfer the supernatant in a new pre-cooled microcentrifuge tube and discard the pellet.
   5. Determine the protein concentration using the BCA Protein Assay kit or other suitable method (e.g. Bradford assay).
      NOTE: Samples can either be frozen at -20 °C or -80 °C for later use, or processed immediately.
   6. Transfer an appropriate volume of lysates to microcentrifuge tubes so that all samples have the same protein concentration and add adequate ice-cold lysis buffer to make up all the lysates to the same volume.
      NOTE: 30 to 50 µg of total protein should be sufficient for most of proteins, but the appropriate quantity to be loaded should be determined according to the abundance of the protein of interest.
   7. Add an appropriate amount of 2x Laemmli buffer (4% SDS, 10% 2-mercaptoethanol, 20% glycerol, 0.004% bromophenol blue, 0.125 M Tris-HCl, pH 6.8) and boil the samples at 95 °C for 5 min.
   8. Load the samples on an acrylamide gel along with a molecular weight marker. Run the gel at 100 V for 1-2 h.
      NOTE: The gel percentage depends on the size of the protein of interest.
   9. Assemble the transfer sandwich and transfer the proteins from the gel onto a membrane at 100 V for 2 h. The membrane can be either nitrocellulose or PVDF. Activate PVDF with methanol for 1 min and rinse it with transfer buffer before preparing the stack.
   10. Block the membrane for 1 h at room temperature using blocking buffer (5% milk in PBST (PBS + 0.1% Tween-20)), then incubate the membrane overnight at 4 °C with primary antibody diluted in blocking buffer.
   11. Wash the membrane for 10 min in PBST three times and incubate it with HRP-conjugated secondary antibody in blocking buffer for 1 h at room temperature.
   12. Wash the membrane for 10 min in PBS four times, then apply the chemiluminescent substrate to the membrane and capture the chemiluminescent signals using a CCD camera-based imager.
   13. Use image analysis software to quantify the knockdown efficiency.
10. Select the two most efficient miRs targeting non-overlapping sequences for further functional assays.
    NOTE: Off-targets effects can never be entirely ruled out for any miR. However, if two independent miRs have a similar effect, it is extremely unlikely that this is because of a same off-target knockdown.
11. If the knockdown efficiency of the selected miRs is not satisfactory (<50%), screen for other miRs. Alternatively, express the most efficient miR(s) in tandem, i.e. express them in multiple copies from the same expression cassette, which may result in increased knockdown efficiency⁷.

2. Construction of Recombinant Adeno-associated Vectors for Combined Expression of Optogenetic Probes and microRNAs

NOTE: This protocol requires knowledge of the following well-established methods: molecular cloning, DNA sequencing and rAAV production.

1. Clone each of the most efficient miR expression cassettes into the 3'UTR of constructs designed for production of recombinant rAAVs and expression of excitatory optogenetic probes, such as in pAAV-Syn-ChETA-TdT-miR-X (Figure 1A), where the neuron-specific synapsin promoter drives expression of the ultrafast channelrhodopsin ChETA, the red fluorescent reporter TdTomato, and miR(s) inserted between the NheI and EcoRI sites⁵.
   NOTE: (i) Do not surpass the packaging limit of rAAVs, which is approximately 4.7 Kb in length from ITR (inverted terminal repeat) to ITR (Figure 1A, orange). (ii) The miR expression cassette needs to be inserted between the stop codon and WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element; Figure 1A). (iii) Inclusion of a fluorescent protein, such as TdTomato, is extremely useful as it allows for readily monitoring the localization and intensity of infection (protocol step 4).
2. Use DNA sequencing to validate the correct insertion of the miR cassettes.
3. Produce and titer rAAV1/2 according to the previously published protocol⁸, one rAAV1/2 for each selected miR. One typical experiment for the knockdown of one gene would include two independent miRs against the same gene and one miR control. Aim for a virus titer of ≥10⁹ viral genomes (vg)/µL.
   CAUTION: rAAVs need to be handled in a Biosafety Level 1 (BSL-1) facility. Please check with Institutional Biosafety Committee for detailed information.
   NOTE: If the laboratory does not have a viral facility or if viral titers are not satisfactory, rAAV production can be outsourced. For example, visit https://www.med.upenn.edu/gtp/vectorcore/ or https://vcf.charite.de/en/metas/.

3. Extraction of RNA from Primary Neuronal Cultures for Evaluation of miR Knockdown Efficiency of Endogenous Genes by qRT-PCR

NOTE: (i) This protocol requires knowledge of the following well-established methods: preparation and maintenance of primary neuronal cultures and qRT-PCR. (ii) Repeat the quantification of knockdown efficiency (steps 3.1–3.14) at least 3 times (biological replicates). (iii) Estimation of knockdown efficiency at the mRNA level by qRT-PCR is suitable when an analysis of the protein content is precluded, such as when knocking down alternatively spliced isoforms for which specific antibodies are not available⁵.

1. Prepare primary neuronal cultures from the brain region of interest. Follow the protocol for cortical cultures given in previous publication⁹, with the following modifications:
   1. Plate neurons in 6 well plates at a density of 500,000 neurons per well. Use 2.5 mL/well of attachment medium and 3.3 mL/well of maintenance medium.
   2. If astrocyte overgrowth is observed, add 0.5 mL/well of maintenance medium supplemented with 7.5 µM of cytosine β-D-arabinofuranoside (for a final concentration of 1 µM) at 3–4 days in vitro (DIV).
2. Infect three wells per miR (technical replicates) at 5–6 DIV. Use the lowest infectious dose which will infect ≥99% of the neurons.
   1. Remove 2 mL of medium from each well and collect it in a 50 mL falcon tube.
   2. Add virus directly to the neurons, mix gently and place the plates back in the incubator at 37 °C.
   3. Store the collected medium in the incubator. Loose the cap of the falcon tube to allow gas equilibration.
   4. After 24 h, add the removed medium back in each well (1.9 mL/well).
3. At 17–18 DIV, lyse the neurons for RNA extraction.
   CAUTION: Lysis Reagent and chloroform are highly toxic. Work under a chemical hood and wear protective gear; dispose of waste according to your national and institutional guidelines.
   NOTE: For steps 3.3–3.13, work in RNAse-free conditions. Wear gloves and use RNAse-free glassware and disposable plasticware. For general precautions on how to handle RNA, consult for example Appendix A of the RNeasy Micro Handbook available online.
   1. Incubate glass Pasteur pipettes overnight in an oven at 180 °C.
   2. Tilt the plates and aspirate the medium completely from each well using a glass Pasteur pipette connected to a vacuum pump.
   3. Immediately add 700 µL of Lysis Reagent to each well.
   4. Spread the solution evenly by rocking and shaking the plate carefully and briefly by hand.
   5. Pipette the solution up and down 4–5 times or until a homogeneous suspension is obtained.
   6. Transfer the solution from each well into a separate 1.5 mL Eppendorf tube.
      NOTE: The cell lysates can be stored at -80 °C or processed immediately.
4. If required, defrost cell the lysates at RT, and proceed immediately to step 3.5.
5. Add 140 µL of chloroform to each sample of cell lysates.
   NOTE: Chloroform is volatile and difficult to pipette, close the Eppendorf tubes as soon as possible.
6. Shake the Eppendorf tubes vigorously for 15 s or until the samples are fully emulsified.
7. Keep the sample at RT for 1–2 min or until the liquid phases start to separate.
8. Centrifuge the samples at 12,000 x g for 15 min at 4 °C.
9. Transfer the upper aqueous phase (~320 µL) containing RNA to a new Eppendorf tube, and discard the remaining liquid.
   NOTE: Do not touch the lower pink organic phase or the white ring between the two phases with the tip of the pipette.
10. Add 1.5 volumes of 100% ethanol (480 µL) to the aqueous phase, and pipette the solution slowly up and down 3 times to mix.
11. Purify RNA using a commercially available kit designed for purification of RNA from small samples.
12. Quantify RNA concentration and sample purity with a spectrophotometer.
    NOTE: (i) Expect yields of ≥3.5 µg/well; the 260/280 and 260/230 ratios for purity over proteins and organic compounds should both be ≥1.9. (ii) The RNA samples can be stored at -80 °C or processed immediately.
13. Retrotranscribe 250, 500 or 1000 ng of RNA with a commercially available kit.
14. Quantify the knockdown efficiency for the endogenous gene of interest by qRT-PCR. For a detailed protocol, see reference¹⁰. Aim for a knockdown efficiency of ≥60% (Figure 2). Normalize the data to ≥2 housekeeping genes (e.g. GAPDH, ACTB, TUBB3, PPIA) using the multiple internal control gene method¹¹.
    NOTE: If working in rat, use the following PCR primers for the housekeeping genes: GAPDH-fwd: 5' GGTGCTGAGTATGTCGTGGA 3' and GAPDH-rev: 5' GATGATGACCCTTTTGGC 3'; ACTB-fwd: 5' CATCACTATCGGCAATGAGC 3' and ACTB-rev: 5' TCATGGATGCCACAGGATT 3'; TUBB3-fwd: 5' GCCTTTGGACACCTATTCAG 3' and TUBB3-rev: 5' TCACATTCTTTCCTCACGAC 3'; PPIA-fwd: 5' CACTGGGGAGAAAGGATTTG 3' and PPIA-rev 5' CCATTATGGCGTGTGAAGTC 3'.

4. Assessing the Role of Presynaptic Proteins in Intact Neuronal Circuits by Targeted Stimulation of Knocked-down Neurons with Optogenetics

NOTE: The following protocol requires previous experience with electrophysiological recordings in acute brain slices and access to an electrophysiological setup.

1. Stereotactically inject rAAV1/2 into the brain following a detailed protocol in previous publication¹². Determine the stereotactic coordinates for the brain region of interest using stereotactic atlases for mouse¹³ or rat brain¹⁴.
   1. Use a micropipette puller to pull injection micropipettes with long shanks of Ø 7–9 µm; clip the injection micropipettes on the shanks with scissors. Use a thin marker and graph paper to place calibrating marks on the injection micropipettes every 2 mm.
   2. Anesthetize the animal with isoflurane and fix it in the stereotactic apparatus.
   3. Keep the animal warm throughout the operation with a heating pad set at 37 °C.
   4. Protect the eyes with ocular lubricant.
   5. Shave the fur on the head with an electric razor.
   6. Spread povidone iodine on the shaved head using a cotton bud.
   7. Under a dissecting microscope, make a midline incision.
   8. Clean the skull surface with a cotton bud, so to make the bregma and lambda visible.
   9. Place the injection micropipette into its holder. Attach the holder to the stereotactic arm.
   10. Determine the x and y coordinates of the site of injection relative to the bregma and/or the lambda.
   11. Use a drill to thin the skull over the target area.
       NOTE: Use gentle circular movements and avoid drilling through the skull as this will damage the surface of the brain.
   12. If there is bleeding, absorb excessive blood with towel paper.
       NOTE: Excessive blood will make it difficult to determine correctly the z coordinate.
   13. Load ≤2 µL of virus into the injection micropipette by capillary action.
   14. Bring the injection micropipette to the x and y coordinates of the site of injection.
   15. Calculate the z coordinate from the dura and lower the pipette slowly into the brain.
   16. When the z coordinate is reached, wait 3 min to allow for tissue adjustment.
   17. Apply low positive pressure using a 1 mL syringe connected via a flexible tube to the back of the injection micropipette. Visually monitor the speed of ejection of the virus from the injection micropipette through the dissection microscope and using the calibrating marks as reference points.
       NOTE: Virus needs to be injected at slow rate (<100 nL/min) to avoid tissue damage.
   18. When injection is finished, wait 5 min, withdraw the injection micropipette by 0.2 mm, wait for another 5 min, to avoid backflow of the virus.
   19. Withdraw the injection micropipette slowly and completely from the brain and dispose of it into a container filled with bleach.
   20. Wet the skull with physiological solution and suture the skin with 3-4 stitches.
   21. Apply gentamicin ointment to the wound.
   22. Single-house the animal in a clean cage with food pellets and under a heat lamp till it fully recovers.
2. ≥15 days post-injection, decapitate animals under deep isoflurane anesthesia.
3. Prepare acute brain slices of the brain region of interest with a Vibratome using gassed (95% O₂, 5% CO₂) ice-cold aCSF solution, containing (in mM): 123 NaCl, 1.25 KCl, 1.25 KH₂PO₄, 1.5 MgCl₂, 1 CaCl₂, 25 NaHCO₃, 2 NaPyruvate and 18 glucose (osmolarity adjusted to 300 mOsm). For example, if the aim is to analyze synaptic transmission from CA3 to CA1 pyramidal neurons, prepare sagittal slices of the hippocampal formation (350 µm thick).
   NOTE: From this step onwards work under low-light conditions to avoid activation of the optogenetic probe by environmental light.
4. Let the slices recover for 30 min at 37 °C in the same aCSF in a chamber designed for holding brain slices. Keep the slices in the same brain slice chamber at room temperature till recording.
   NOTE: Using these conditions, slices can be maintained healthy for up to 6–8 h.
5. Transfer one slice to a submerged recording chamber and superfuse it with 2 mL/min of the same aCSF used for recovery supplemented with 1.5 mM CaCl₂ (total Ca²⁺: 2.5 mM) and without NaPyruvate.
   NOTE: Slices are prepared and maintained in low concentration of Ca²⁺ (1 mM) to minimize toxicity. Recordings are performed in 2.5 mM Ca²⁺ to favor vesicle release.
6. Check briefly the signal of the expressed fluorescent reporter (e.g. TdTomato; Figure 3B) to ascertain the localization and intensity of infection.
7. Fill a patch electrode with an intracellular solution containing (in mM): 110 K-gluconate, 22 KCl, 5 NaCl, 0.5 EGTA, 3 MgCl₂, 4 Mg-ATP, 0.5 Na₃-GTP, 20 K₂-creatine phosphate, 10 HEPES-KOH (pH 7.28, 290 mΩ).
   NOTE: Use patch electrode with a pipette resistance of 5–6 mΩ.
8. Under infrared illumination, reach tight-seal whole-cell configuration from a neuron receiving synaptic inputs from the infected neurons. For example, if CA3 pyramidal neurons were infected, patch pyramidal neurons in the proximal to medial tract of the CA1 region (Figure 3C).
   NOTE: Series resistance can be left uncompensated, but it should be constant and low (≤20 MΩ).
9. Use pharmacology to isolate the synaptic currents under investigation. For example, if the aim is to investigate excitatory synaptic transmission, block inhibitory synaptic transmission with 10 µM bicuculline.
10. Evoke synaptic currents, for example, excitatory postsynaptic currents (EPSCs), using a 473 nm blue laser coupled to an optical fiber (Ø ≤250 µm) positioned on the somata of the infected neurons (e.g. CA3 pyramidal neurons).
    1. Adjust stimulation length to a minimum, to reduce the possibility of evoking more than one action potential per light pulse. If using ChETA, set it to 2 ms¹⁵.
    2. Adjust stimulation strength of the laser to yield small but clearly detectable synaptic currents (≤50 pA peak amplitude for EPSCs recorded at a holding potential of -70 mV between CA3 and CA1 pyramidal neurons; Figure 3D). If using ChETA and an optical fiber of 250 µm in diameter, stimulation strengths of 1–3 mW at fiber exit should be suitable.
       NOTE: if laser strength cannot be regulated, use neutral density filters.
    3. Shine the 473 nm laser light on the somata of the infected neurons, but not on their axons. For example, shine the light on CA3 somata, and away from the Schaffer collaterals, to avoid direct depolarization of the axons.
    4. Apply tetrodotoxin (TTX; 0.5 µM), a blocker of sodium channels, to the sample to confirm the channels are action potential-driven.
    5. In different recordings, apply a selective blocker to the synaptic current under investigation to confirm the stimulation is selective.
       NOTE: For example, apply NBQX (10 µM) to AMPA-type glutamate receptor-mediated EPSCs.
    6. Compare optically and electrically evoked synaptic currents in the same acute brain slice in response to repetitive stimulation (≥2 stimuli at ≤20 Hz). A similar degree of synaptic facilitation or depression should be observed between electrical and optical stimulation when using a control miR, thus suggesting that similar cellular mechanisms are activated by the two types of stimulations.
       NOTE: The above steps are necessary to ensure that optical stimulation does not induce a direct depolarization of presynaptic boutons, thus bypassing some mechanisms of synaptic transmission.
11. Compare synaptic transmission in response to single and repetitive stimulations (≥2 stimuli at ≤20 Hz) between a control miR and miRs targeting the presynaptic proteins under investigation.